View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-1 (Length: 250)

Name: F9285J-LTR4-TNT-insertion-1
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-1
F9285J-LTR4-TNT-insertion-1
[»] chr6 (1 HSPs)
chr6 (7-240)||(30026299-30026532)
[»] chr8 (1 HSPs)
chr8 (98-204)||(6931612-6931718)
[»] chr2 (2 HSPs)
chr2 (98-204)||(39169540-39169646)
chr2 (79-204)||(17161084-17161209)
[»] chr7 (3 HSPs)
chr7 (98-204)||(42469957-42470063)
chr7 (98-204)||(28427168-28427274)
chr7 (113-177)||(5265729-5265793)
[»] chr1 (1 HSPs)
chr1 (81-199)||(34339763-34339881)


Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 240
Target Start/End: Complemental strand, 30026532 - 30026299
Alignment:
7 accatcattataaatatggcataagttaaaagagataagattaagagagnnnnnnncaaatataaaaggattagagtcgtgtcataattatcataagaag 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
30026532 accatcattataaatatggcataagttaaaagagataagattaagagagaaaaaaacaaatataaaaggattagagtcgtgtcataattatcataagaag 30026433  T
107 aattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggtagccttcga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30026432 aattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggtagccttcga 30026333  T
207 atgtcatgcacaagaaaaaagagcagccaaatta 240  Q
    ||||||||||||||||||||||||||||||||||    
30026332 atgtcatgcacaagaaaaaagagcagccaaatta 30026299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 204
Target Start/End: Original strand, 6931612 - 6931718
Alignment:
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||||||  |  ||||| ||||| |||| | | |||||||||||||    
6931612 cataagaaaaattgaatatttgaaggaacacaaaggcgccaaatccaattccaactttcttccccaagcaatgaagtctgagctcccattaaccactggt 6931711  T
198 agccttc 204  Q
    |||||||    
6931712 agccttc 6931718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 39169646 - 39169540
Alignment:
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||||||| ||||||||||||||||||  |  ||||| ||||| |||| | |||||||||||||||    
39169646 cataagaaaaattgaatatttgaaggaacacaaaggcgccaattccaattccaactttcttccccaagcaatgaagtctgagctcctattaaccactggt 39169547  T
198 agccttc 204  Q
    |||||||    
39169546 agccttc 39169540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 204
Target Start/End: Complemental strand, 17161209 - 17161084
Alignment:
79 agagtcgtgtcataattatcataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatga 178  Q
    ||||||||| || ||||  |||||||||||  | ||||| ||| ||||||| ||| ||||||||||||||||||||||||  | |||||| |||||||||    
17161209 agagtcgtgacacaattgccataagaagaaccgaatatttgaaggaacacagaggtgccaaatccaattccaactttcttccccgagcaatgaagtatga 17161110  T
179 gattctattaaccactggtagccttc 204  Q
    | | | |||||||| |||||||||||    
17161109 gctcccattaaccattggtagccttc 17161084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 42470063 - 42469957
Alignment:
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| | ||| ||||| ||| ||||||||||||||||||||||||||||||||||||  |  ||||| ||||| |||| | | |||||||||||||    
42470063 cataagaaaatttgaatatttgaaggaacacaaaggcgccaaatccaattccaactttcttccccaagcaatgaagtctgagctcccattaaccactggt 42469964  T
198 agccttc 204  Q
    |||||||    
42469963 agccttc 42469957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 28427274 - 28427168
Alignment:
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||| ||||||||||||||||||||||  |  ||||| ||||| |||| |   |||||||||||||    
28427274 cataagaaaaattgaatatttgaaggaacacaaaggcgtcaaatccaattccaactttcttccccaagcaatgaagtctgagctctcattaaccactggt 28427175  T
198 agccttc 204  Q
    |||||||    
28427174 agccttc 28427168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 5265793 - 5265729
Alignment:
113 atattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatg 177  Q
    ||||| ||| |||||||||| || |||||||||||||||| |||||   |||||||| |||||||    
5265793 atatttgaaggaacacaaagacgtcaaatccaattccaaccttcttccatgagcaacaaagtatg 5265729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 81 - 199
Target Start/End: Original strand, 34339763 - 34339881
Alignment:
81 agtcgtgtcataattatcataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgaga 180  Q
    ||||||| ||||||| |||  ||||||| |  ||||| ||| ||||||| || ||| |||| ||||||||||||||||  | ||||||||||||||| |     
34339763 agtcgtggcataattgtcaatagaagaagtatatatttgaaggaacacatagtcgcgaaattcaattccaactttcttccccgagcaacgaagtatgggc 34339862  T
181 ttctattaaccactggtag 199  Q
    | | |||||||||||||||    
34339863 tcccattaaccactggtag 34339881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98057 times since January 2019
Visitors: 2269