View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-1 (Length: 250)

Name: F9285J-LTR4-TNT-insertion-1
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-1
[»] chr6 (1 HSPs)
chr6 (7-240)||(30026299-30026532)
[»] chr8 (1 HSPs)
chr8 (98-204)||(6931612-6931718)
[»] chr2 (2 HSPs)
chr2 (98-204)||(39169540-39169646)
chr2 (79-204)||(17161084-17161209)
[»] chr7 (3 HSPs)
chr7 (98-204)||(42469957-42470063)
chr7 (98-204)||(28427168-28427274)
chr7 (113-177)||(5265729-5265793)
[»] chr1 (1 HSPs)
chr1 (81-199)||(34339763-34339881)

Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 240
Target Start/End: Complemental strand, 30026532 - 30026299
7 accatcattataaatatggcataagttaaaagagataagattaagagagnnnnnnncaaatataaaaggattagagtcgtgtcataattatcataagaag 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
30026532 accatcattataaatatggcataagttaaaagagataagattaagagagaaaaaaacaaatataaaaggattagagtcgtgtcataattatcataagaag 30026433  T
107 aattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggtagccttcga 206  Q
30026432 aattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggtagccttcga 30026333  T
207 atgtcatgcacaagaaaaaagagcagccaaatta 240  Q
30026332 atgtcatgcacaagaaaaaagagcagccaaatta 30026299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 204
Target Start/End: Original strand, 6931612 - 6931718
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||||||||||  |  ||||| ||||| |||| | | |||||||||||||    
6931612 cataagaaaaattgaatatttgaaggaacacaaaggcgccaaatccaattccaactttcttccccaagcaatgaagtctgagctcccattaaccactggt 6931711  T
198 agccttc 204  Q
6931712 agccttc 6931718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 39169646 - 39169540
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||||||| ||||||||||||||||||  |  ||||| ||||| |||| | |||||||||||||||    
39169646 cataagaaaaattgaatatttgaaggaacacaaaggcgccaattccaattccaactttcttccccaagcaatgaagtctgagctcctattaaccactggt 39169547  T
198 agccttc 204  Q
39169546 agccttc 39169540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 204
Target Start/End: Complemental strand, 17161209 - 17161084
79 agagtcgtgtcataattatcataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatga 178  Q
    ||||||||| || ||||  |||||||||||  | ||||| ||| ||||||| ||| ||||||||||||||||||||||||  | |||||| |||||||||    
17161209 agagtcgtgacacaattgccataagaagaaccgaatatttgaaggaacacagaggtgccaaatccaattccaactttcttccccgagcaatgaagtatga 17161110  T
179 gattctattaaccactggtagccttc 204  Q
    | | | |||||||| |||||||||||    
17161109 gctcccattaaccattggtagccttc 17161084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr7

Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 42470063 - 42469957
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| | ||| ||||| ||| ||||||||||||||||||||||||||||||||||||  |  ||||| ||||| |||| | | |||||||||||||    
42470063 cataagaaaatttgaatatttgaaggaacacaaaggcgccaaatccaattccaactttcttccccaagcaatgaagtctgagctcccattaaccactggt 42469964  T
198 agccttc 204  Q
42469963 agccttc 42469957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 28427274 - 28427168
98 cataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgagattctattaaccactggt 197  Q
    |||||||| ||||| ||||| ||| ||||||||||||| ||||||||||||||||||||||  |  ||||| ||||| |||| |   |||||||||||||    
28427274 cataagaaaaattgaatatttgaaggaacacaaaggcgtcaaatccaattccaactttcttccccaagcaatgaagtctgagctctcattaaccactggt 28427175  T
198 agccttc 204  Q
28427174 agccttc 28427168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 177
Target Start/End: Complemental strand, 5265793 - 5265729
113 atattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatg 177  Q
    ||||| ||| |||||||||| || |||||||||||||||| |||||   |||||||| |||||||    
5265793 atatttgaaggaacacaaagacgtcaaatccaattccaaccttcttccatgagcaacaaagtatg 5265729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 81 - 199
Target Start/End: Original strand, 34339763 - 34339881
81 agtcgtgtcataattatcataagaagaattggatattggaaagaacacaaaggcgccaaatccaattccaactttcttttctgagcaacgaagtatgaga 180  Q
    ||||||| ||||||| |||  ||||||| |  ||||| ||| ||||||| || ||| |||| ||||||||||||||||  | ||||||||||||||| |     
34339763 agtcgtggcataattgtcaatagaagaagtatatatttgaaggaacacatagtcgcgaaattcaattccaactttcttccccgagcaacgaagtatgggc 34339862  T
181 ttctattaaccactggtag 199  Q
    | | |||||||||||||||    
34339863 tcccattaaccactggtag 34339881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC