View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-10 (Length: 788)

Name: F9285J-LTR4-TNT-insertion-10
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-10
F9285J-LTR4-TNT-insertion-10
[»] chr6 (64 HSPs)
chr6 (10-425)||(29518686-29519101)
chr6 (236-425)||(29518495-29518684)
chr6 (236-425)||(32741171-32741360)
chr6 (177-413)||(2378059-2378295)
chr6 (195-403)||(3409611-3409819)
chr6 (178-418)||(16454838-16455081)
chr6 (125-403)||(2578442-2578730)
chr6 (174-402)||(10073991-10074219)
chr6 (236-392)||(3409251-3409407)
chr6 (125-401)||(16107943-16108208)
chr6 (236-402)||(35210196-35210362)
chr6 (129-394)||(2579500-2579765)
chr6 (204-403)||(10074362-10074560)
chr6 (236-410)||(14748334-14748504)
chr6 (237-404)||(1846741-1846908)
chr6 (236-403)||(3058218-3058385)
chr6 (235-403)||(3415449-3415619)
chr6 (244-402)||(2579872-2580030)
chr6 (125-402)||(2579109-2579387)
chr6 (130-400)||(10073618-10073884)
chr6 (246-404)||(2377756-2377914)
chr6 (246-410)||(16454577-16454741)
chr6 (236-392)||(26544041-26544197)
chr6 (246-393)||(16107680-16107827)
chr6 (236-402)||(1127352-1127518)
chr6 (219-416)||(2578821-2579016)
chr6 (250-403)||(2843560-2843714)
chr6 (244-415)||(593694-593867)
chr6 (246-402)||(5832027-5832182)
chr6 (247-387)||(1950200-1950340)
chr6 (247-399)||(6999799-6999951)
chr6 (249-352)||(32460630-32460733)
chr6 (244-398)||(10911565-10911720)
chr6 (178-369)||(6071064-6071257)
chr6 (250-369)||(9062383-9062501)
chr6 (206-363)||(8481888-8482045)
chr6 (12-108)||(10074240-10074336)
chr6 (244-402)||(12071691-12071849)
chr6 (244-402)||(12092482-12092640)
chr6 (239-396)||(5958613-5958766)
chr6 (146-303)||(33605879-33606034)
chr6 (244-399)||(12085037-12085191)
chr6 (204-317)||(35210449-35210551)
chr6 (174-360)||(2975482-2975668)
chr6 (248-403)||(17135068-17135223)
chr6 (244-399)||(31714671-31714823)
chr6 (10-108)||(3409470-3409567)
chr6 (10-89)||(2579387-2579467)
chr6 (8-100)||(26544230-26544321)
chr6 (348-395)||(3409405-3409452)
chr6 (10-108)||(2377937-2378034)
chr6 (10-89)||(2578730-2578810)
chr6 (10-89)||(16107863-16107943)
chr6 (178-235)||(12092201-12092261)
chr6 (10-78)||(2579779-2579848)
chr6 (281-322)||(14789284-14789325)
chr6 (10-89)||(16454758-16454838)
chr6 (312-356)||(22605301-22605345)
chr6 (312-363)||(11637760-11637811)
chr6 (70-108)||(14789403-14789441)
chr6 (372-416)||(2975033-2975077)
chr6 (312-356)||(21130103-21130147)
chr6 (336-394)||(10902438-10902496)
chr6 (251-385)||(30618634-30618766)
[»] chr8 (85 HSPs)
chr8 (426-778)||(2291993-2292345)
chr8 (158-398)||(3669973-3670214)
chr8 (167-394)||(1013879-1014107)
chr8 (131-400)||(40518470-40518738)
chr8 (235-403)||(3669678-3669846)
chr8 (177-398)||(30359539-30359763)
chr8 (145-398)||(9482608-9482857)
chr8 (128-402)||(8918764-8919039)
chr8 (234-395)||(30441071-30441236)
chr8 (195-403)||(34835160-34835368)
chr8 (147-403)||(45122907-45123165)
chr8 (246-410)||(3038282-3038446)
chr8 (199-403)||(34835427-34835634)
chr8 (199-403)||(34835693-34835900)
chr8 (194-410)||(9309303-9309520)
chr8 (124-403)||(45122515-45122783)
chr8 (236-403)||(1014244-1014411)
chr8 (196-394)||(6731856-6732045)
chr8 (124-392)||(147712-147968)
chr8 (246-394)||(34834878-34835026)
chr8 (246-402)||(37544490-37544646)
chr8 (244-392)||(45122067-45122215)
chr8 (244-402)||(9608745-9608903)
chr8 (134-403)||(18371660-18371925)
chr8 (246-403)||(1513914-1514071)
chr8 (247-403)||(147454-147610)
chr8 (236-425)||(20870550-20870741)
chr8 (244-410)||(6876854-6877021)
chr8 (246-410)||(40518071-40518237)
chr8 (269-398)||(9483191-9483320)
chr8 (181-395)||(45121663-45121878)
chr8 (246-401)||(33113368-33113523)
chr8 (246-402)||(25561815-25561972)
chr8 (246-394)||(30359273-30359421)
chr8 (244-403)||(45121909-45122068)
chr8 (238-396)||(40579512-40579670)
chr8 (244-402)||(5915872-5916025)
chr8 (254-425)||(18371970-18372142)
chr8 (178-316)||(18372342-18372481)
chr8 (251-404)||(70272-70425)
chr8 (215-403)||(6651476-6651653)
chr8 (248-401)||(18380020-18380171)
chr8 (238-425)||(32305478-32305658)
chr8 (244-404)||(41972158-41972321)
chr8 (244-400)||(5420651-5420807)
chr8 (136-316)||(18372785-18372966)
chr8 (244-410)||(9308977-9309147)
chr8 (178-348)||(18372988-18373157)
chr8 (134-288)||(18372485-18372640)
chr8 (247-425)||(32640508-32640682)
chr8 (244-395)||(9507777-9507933)
chr8 (236-332)||(41416241-41416335)
chr8 (246-362)||(8794113-8794229)
chr8 (319-410)||(40579261-40579352)
chr8 (244-392)||(4154678-4154824)
chr8 (129-232)||(3038099-3038202)
chr8 (267-381)||(9609108-9609222)
chr8 (247-357)||(43274824-43274934)
chr8 (178-362)||(4154321-4154506)
chr8 (10-108)||(1014122-1014219)
chr8 (10-108)||(9309164-9309262)
chr8 (246-352)||(18372656-18372758)
chr8 (328-403)||(8919143-8919218)
chr8 (244-410)||(9620670-9620834)
chr8 (248-393)||(43398077-43398225)
chr8 (244-393)||(12283873-12284021)
chr8 (249-349)||(20130454-20130553)
chr8 (254-317)||(25561729-25561792)
chr8 (329-416)||(41129073-41129160)
chr8 (247-326)||(3037784-3037865)
chr8 (338-410)||(43274627-43274699)
chr8 (10-108)||(3669870-3669967)
chr8 (244-370)||(5274775-5274901)
chr8 (344-416)||(18372269-18372342)
chr8 (355-410)||(3037961-3038016)
chr8 (330-382)||(16524451-16524503)
chr8 (280-336)||(18373236-18373292)
chr8 (321-385)||(20995433-20995497)
chr8 (247-343)||(40991756-40991852)
chr8 (194-270)||(43274699-43274777)
chr8 (13-93)||(147637-147718)
chr8 (244-301)||(20995502-20995559)
chr8 (244-321)||(33831978-33832055)
chr8 (125-162)||(9483047-9483084)
chr8 (315-352)||(12156708-12156745)
[»] chr7 (79 HSPs)
chr7 (112-370)||(7553891-7554151)
chr7 (211-410)||(37533003-37533201)
chr7 (167-399)||(14681431-14681663)
chr7 (181-410)||(30244204-30244436)
chr7 (124-410)||(45434514-45434802)
chr7 (244-425)||(1085593-1085774)
chr7 (236-410)||(37533356-37533530)
chr7 (244-410)||(23369-23535)
chr7 (251-410)||(11845198-11845357)
chr7 (193-410)||(30245024-30245239)
chr7 (244-402)||(7517580-7517738)
chr7 (238-399)||(29157559-29157720)
chr7 (244-404)||(40094772-40094932)
chr7 (246-409)||(6054562-6054725)
chr7 (244-415)||(22567026-22567196)
chr7 (244-394)||(36939741-36939891)
chr7 (181-363)||(22566702-22566885)
chr7 (246-403)||(45433243-45433400)
chr7 (244-403)||(24177435-24177594)
chr7 (129-370)||(1085280-1085526)
chr7 (246-391)||(45754718-45754862)
chr7 (252-392)||(19122740-19122879)
chr7 (250-410)||(34218026-34218186)
chr7 (244-415)||(8128428-8128599)
chr7 (244-402)||(118299-118459)
chr7 (249-410)||(30032572-30032733)
chr7 (246-402)||(47129097-47129253)
chr7 (247-400)||(9901648-9901799)
chr7 (244-401)||(36622960-36623117)
chr7 (244-364)||(16569196-16569316)
chr7 (244-364)||(16596346-16596466)
chr7 (174-314)||(30244628-30244771)
chr7 (137-317)||(30245385-30245567)
chr7 (244-403)||(40230290-40230449)
chr7 (265-410)||(37167808-37167947)
chr7 (244-403)||(41854635-41854793)
chr7 (247-379)||(24838724-24838857)
chr7 (215-317)||(30255308-30255412)
chr7 (10-99)||(37532897-37532986)
chr7 (247-399)||(20599317-20599471)
chr7 (286-410)||(30253534-30253654)
chr7 (244-393)||(36534795-36534942)
chr7 (10-96)||(37533253-37533339)
chr7 (174-294)||(40094502-40094621)
chr7 (328-402)||(47129453-47129527)
chr7 (244-365)||(43241495-43241616)
chr7 (146-362)||(37345819-37346036)
chr7 (247-396)||(41910592-41910749)
chr7 (290-400)||(28300255-28300366)
chr7 (332-410)||(37532743-37532821)
chr7 (244-332)||(28301613-28301701)
chr7 (125-240)||(48243241-48243356)
chr7 (10-117)||(22566905-22567013)
chr7 (244-312)||(36109007-36109075)
chr7 (249-349)||(44361517-44361616)
chr7 (328-401)||(28300569-28300643)
chr7 (13-106)||(14681323-14681415)
chr7 (113-209)||(47129343-47129439)
chr7 (198-362)||(4124128-4124293)
chr7 (174-263)||(45697841-45697929)
chr7 (311-362)||(21416181-21416232)
chr7 (8-93)||(28300470-28300554)
chr7 (178-257)||(10342192-10342271)
chr7 (313-361)||(23569043-23569091)
chr7 (345-401)||(30244453-30244509)
chr7 (345-425)||(30253671-30253751)
chr7 (60-108)||(45697752-45697800)
chr7 (238-281)||(14681281-14681324)
chr7 (312-391)||(40094424-40094503)
chr7 (345-403)||(30245256-30245314)
chr7 (339-393)||(4719305-4719359)
chr7 (246-296)||(36967335-36967385)
chr7 (311-356)||(21619091-21619136)
chr7 (124-237)||(28300365-28300476)
chr7 (336-389)||(45755019-45755072)
chr7 (10-88)||(40094664-40094742)
chr7 (27-89)||(48243356-48243419)
chr7 (365-399)||(5825587-5825621)
chr7 (299-404)||(37393114-37393218)
[»] chr1 (89 HSPs)
chr1 (171-410)||(44290450-44290690)
chr1 (167-399)||(48588491-48588724)
chr1 (154-403)||(26661521-26661773)
chr1 (137-394)||(34364816-34365075)
chr1 (125-393)||(37555990-37556260)
chr1 (234-410)||(44290816-44290993)
chr1 (124-401)||(41157254-41157532)
chr1 (177-403)||(22077494-22077719)
chr1 (178-323)||(3537226-3537372)
chr1 (236-402)||(3537599-3537765)
chr1 (236-402)||(41759475-41759641)
chr1 (244-404)||(41142372-41142533)
chr1 (217-404)||(11977251-11977440)
chr1 (246-410)||(17294579-17294744)
chr1 (236-398)||(3550712-3550871)
chr1 (244-403)||(41156991-41157150)
chr1 (142-410)||(66081-66349)
chr1 (252-404)||(14318875-14319027)
chr1 (244-394)||(34364507-34364657)
chr1 (241-387)||(38804370-38804516)
chr1 (236-410)||(50052016-50052189)
chr1 (245-394)||(40082408-40082556)
chr1 (244-403)||(29798199-29798358)
chr1 (244-403)||(31767160-31767319)
chr1 (246-404)||(34649440-34649598)
chr1 (128-403)||(22077109-22077393)
chr1 (238-371)||(32594747-32594880)
chr1 (235-403)||(45493973-45494146)
chr1 (236-402)||(32168698-32168853)
chr1 (244-403)||(45084382-45084535)
chr1 (244-402)||(5319965-5320123)
chr1 (244-425)||(3875308-3875489)
chr1 (248-402)||(9955911-9956067)
chr1 (244-402)||(37850600-37850758)
chr1 (174-392)||(30630648-30630866)
chr1 (244-398)||(66476-66630)
chr1 (246-379)||(26661921-26662054)
chr1 (247-393)||(37555733-37555878)
chr1 (244-404)||(24600312-24600472)
chr1 (244-403)||(39066200-39066358)
chr1 (244-403)||(41184407-41184583)
chr1 (171-276)||(50051777-50051883)
chr1 (254-394)||(5528762-5528902)
chr1 (235-364)||(44043810-44043944)
chr1 (250-403)||(5575110-5575261)
chr1 (244-396)||(24131994-24132143)
chr1 (244-400)||(22077831-22077986)
chr1 (245-396)||(22793279-22793431)
chr1 (246-392)||(45839629-45839779)
chr1 (315-413)||(11977015-11977113)
chr1 (244-402)||(19283455-19283613)
chr1 (174-296)||(47379891-47380012)
chr1 (22-105)||(11977141-11977224)
chr1 (13-108)||(48588739-48588833)
chr1 (244-410)||(21378051-21378199)
chr1 (10-117)||(26661766-26661873)
chr1 (244-392)||(44685456-44685605)
chr1 (10-108)||(50051902-50051999)
chr1 (314-403)||(50051688-50051776)
chr1 (129-229)||(41184198-41184298)
chr1 (175-303)||(50469180-50469306)
chr1 (178-393)||(24448212-24448426)
chr1 (10-108)||(48588364-48588461)
chr1 (10-89)||(44290720-44290798)
chr1 (244-362)||(1188628-1188746)
chr1 (286-362)||(10351202-10351278)
chr1 (244-362)||(1187404-1187522)
chr1 (259-401)||(44091909-44092051)
chr1 (271-391)||(4956218-4956340)
chr1 (10-90)||(34364690-34364771)
chr1 (10-93)||(34649622-34649705)
chr1 (164-229)||(3537495-3537562)
chr1 (244-291)||(35154150-35154197)
chr1 (174-240)||(1188392-1188457)
chr1 (244-310)||(4878803-4878869)
chr1 (14-88)||(22077392-22077466)
chr1 (343-402)||(4266798-4266855)
chr1 (13-91)||(66366-66444)
chr1 (10-99)||(3537410-3537494)
chr1 (236-309)||(4266875-4266948)
chr1 (293-338)||(41184152-41184197)
chr1 (285-401)||(9499020-9499136)
chr1 (253-312)||(30630912-30630972)
chr1 (299-359)||(35154046-35154106)
chr1 (198-262)||(47380258-47380323)
chr1 (328-362)||(12466367-12466401)
chr1 (14-92)||(22077722-22077800)
chr1 (10-47)||(9956092-9956129)
chr1 (124-193)||(34649699-34649767)
[»] chr3 (93 HSPs)
chr3 (171-403)||(22304495-22304728)
chr3 (134-409)||(37990632-37990908)
chr3 (130-403)||(54017815-54018090)
chr3 (128-403)||(21832344-21832614)
chr3 (198-400)||(42342092-42342296)
chr3 (246-400)||(43346793-43346947)
chr3 (246-403)||(35946524-35946681)
chr3 (158-403)||(41359764-41360008)
chr3 (167-385)||(4823578-4823796)
chr3 (244-403)||(29644901-29645060)
chr3 (112-376)||(3135099-3135364)
chr3 (194-403)||(29644580-29644792)
chr3 (181-396)||(15773127-15773346)
chr3 (174-402)||(32462558-32462790)
chr3 (244-403)||(12114561-12114720)
chr3 (246-401)||(37990978-37991133)
chr3 (244-403)||(42342387-42342546)
chr3 (244-410)||(32589704-32589869)
chr3 (244-400)||(15772854-15773010)
chr3 (244-403)||(33803251-33803410)
chr3 (235-394)||(39934963-39935124)
chr3 (236-393)||(39389062-39389219)
chr3 (246-410)||(52634678-52634841)
chr3 (244-403)||(25739424-25739583)
chr3 (244-403)||(54018197-54018356)
chr3 (174-395)||(9240079-9240300)
chr3 (246-399)||(32462903-32463057)
chr3 (209-403)||(22303954-22304143)
chr3 (236-403)||(50612446-50612618)
chr3 (154-412)||(11661858-11662119)
chr3 (246-404)||(25755396-25755554)
chr3 (246-403)||(3135453-3135617)
chr3 (244-402)||(31190017-31190167)
chr3 (244-413)||(53577364-53577533)
chr3 (244-399)||(45395656-45395811)
chr3 (206-299)||(22304208-22304301)
chr3 (244-391)||(39914252-39914399)
chr3 (246-402)||(45901715-45901872)
chr3 (244-403)||(1634314-1634473)
chr3 (244-411)||(8327904-8328075)
chr3 (245-403)||(53117974-53118131)
chr3 (10-119)||(22303820-22303929)
chr3 (246-394)||(49336694-49336843)
chr3 (244-403)||(44160546-44160702)
chr3 (236-404)||(37726496-37726656)
chr3 (302-399)||(22303662-22303759)
chr3 (236-398)||(51886553-51886709)
chr3 (246-415)||(33175646-33175820)
chr3 (254-397)||(42584829-42584970)
chr3 (318-403)||(41359490-41359575)
chr3 (225-376)||(47964544-47964694)
chr3 (270-368)||(33362327-33362425)
chr3 (233-351)||(3384317-3384435)
chr3 (244-403)||(39336231-39336387)
chr3 (124-233)||(8328259-8328368)
chr3 (247-336)||(7767380-7767469)
chr3 (246-311)||(11661537-11661602)
chr3 (314-403)||(54017547-54017636)
chr3 (244-300)||(43346650-43346706)
chr3 (10-78)||(53577548-53577616)
chr3 (244-403)||(47964914-47965073)
chr3 (353-403)||(22304302-22304352)
chr3 (247-352)||(46546375-46546480)
chr3 (10-108)||(22304378-22304476)
chr3 (311-362)||(53596027-53596078)
chr3 (311-362)||(53596342-53596393)
chr3 (124-193)||(8328154-8328222)
chr3 (348-401)||(8328374-8328427)
chr3 (286-370)||(39336002-39336086)
chr3 (294-354)||(52634990-52635050)
chr3 (10-108)||(41360014-41360111)
chr3 (286-391)||(12749211-12749316)
chr3 (246-362)||(25991405-25991521)
chr3 (10-92)||(15773037-15773119)
chr3 (299-356)||(17731950-17732007)
chr3 (299-356)||(19033181-19033238)
chr3 (247-376)||(25317161-25317290)
chr3 (328-410)||(43978857-43978943)
chr3 (178-276)||(12747878-12747977)
chr3 (311-362)||(53596542-53596593)
chr3 (328-362)||(11661604-11661638)
chr3 (198-240)||(52634889-52634931)
chr3 (10-64)||(53577667-53577721)
chr3 (199-268)||(2299930-2300000)
chr3 (53-108)||(4823507-4823563)
chr3 (328-403)||(7766782-7766855)
chr3 (10-93)||(33803143-33803227)
chr3 (14-89)||(54018093-54018169)
chr3 (323-362)||(48127642-48127681)
chr3 (311-358)||(48127859-48127906)
chr3 (24-73)||(29644811-29644860)
chr3 (249-310)||(36986040-36986101)
chr3 (249-310)||(37011479-37011540)
[»] scaffold0734 (2 HSPs)
scaffold0734 (112-393)||(5643-5931)
scaffold0734 (244-393)||(5396-5546)
[»] chr2 (83 HSPs)
chr2 (171-410)||(5542617-5542857)
chr2 (212-400)||(37106156-37106344)
chr2 (235-410)||(36178597-36178772)
chr2 (178-399)||(40679632-40679852)
chr2 (236-410)||(14745659-14745833)
chr2 (240-410)||(37105920-37106090)
chr2 (172-395)||(14745300-14745524)
chr2 (216-410)||(15880233-15880429)
chr2 (234-398)||(5543002-5543166)
chr2 (246-410)||(6421387-6421551)
chr2 (236-403)||(41283474-41283641)
chr2 (124-403)||(6421996-6422269)
chr2 (124-397)||(7598488-7598754)
chr2 (130-400)||(28531316-28531583)
chr2 (116-403)||(3672954-3673227)
chr2 (244-404)||(962598-962758)
chr2 (177-403)||(40733813-40734041)
chr2 (244-410)||(42514649-42514815)
chr2 (201-403)||(40733472-40733676)
chr2 (262-410)||(36178163-36178311)
chr2 (112-301)||(36785664-36785854)
chr2 (244-403)||(35580723-35580881)
chr2 (211-351)||(36178320-36178460)
chr2 (246-404)||(6712978-6713137)
chr2 (251-402)||(15511495-15511646)
chr2 (246-395)||(36005887-36006035)
chr2 (194-401)||(29676851-29677065)
chr2 (249-400)||(33731653-33731804)
chr2 (244-401)||(38796619-38796778)
chr2 (136-322)||(38796298-38796487)
chr2 (244-397)||(37632602-37632755)
chr2 (236-392)||(1769884-1770040)
chr2 (257-425)||(23346250-23346417)
chr2 (248-383)||(28254258-28254391)
chr2 (246-388)||(5367457-5367599)
chr2 (178-409)||(30313110-30313342)
chr2 (244-402)||(7598228-7598386)
chr2 (255-391)||(40163383-40163520)
chr2 (128-306)||(42514899-42515078)
chr2 (178-361)||(30323396-30323581)
chr2 (224-352)||(31468800-31468926)
chr2 (306-416)||(6421793-6421903)
chr2 (178-362)||(33561491-33561675)
chr2 (244-392)||(12529038-12529186)
chr2 (244-351)||(16542449-16542556)
chr2 (252-402)||(29676543-29676687)
chr2 (247-360)||(31259658-31259774)
chr2 (178-352)||(33953821-33953994)
chr2 (244-415)||(16590888-16591054)
chr2 (246-403)||(29874022-29874179)
chr2 (247-332)||(31899496-31899581)
chr2 (178-351)||(41678419-41678593)
chr2 (204-362)||(37894732-37894889)
chr2 (10-118)||(29676711-29676819)
chr2 (208-425)||(29873514-29873732)
chr2 (252-356)||(37895107-37895211)
chr2 (316-403)||(3672773-3672860)
chr2 (306-403)||(6421688-6421785)
chr2 (247-402)||(9231252-9231407)
chr2 (10-83)||(36178508-36178581)
chr2 (297-389)||(36784273-36784365)
chr2 (10-108)||(14745544-14745641)
chr2 (8-93)||(7598409-7598494)
chr2 (260-349)||(28254165-28254254)
chr2 (245-360)||(31385738-31385853)
chr2 (334-402)||(31899102-31899170)
chr2 (199-266)||(40734231-40734300)
chr2 (247-351)||(12910231-12910335)
chr2 (10-57)||(37106107-37106154)
chr2 (10-92)||(40734067-40734149)
chr2 (246-292)||(6421306-6421352)
chr2 (117-227)||(23346489-23346594)
chr2 (308-403)||(35580438-35580534)
chr2 (247-400)||(3594180-3594333)
chr2 (286-410)||(30312831-30312956)
chr2 (10-108)||(5542876-5542973)
chr2 (187-240)||(34481588-34481642)
chr2 (174-255)||(35580532-35580616)
chr2 (298-357)||(25390313-25390372)
chr2 (311-362)||(28226404-28226455)
chr2 (178-217)||(33954064-33954103)
chr2 (10-48)||(35580661-35580699)
chr2 (286-343)||(2336666-2336723)
[»] chr5 (80 HSPs)
chr5 (112-388)||(13415774-13416051)
chr5 (171-403)||(6500749-6500981)
chr5 (132-416)||(3295001-3295287)
chr5 (124-410)||(624077-624362)
chr5 (236-403)||(6500443-6500609)
chr5 (244-403)||(40296314-40296473)
chr5 (241-401)||(36492218-36492378)
chr5 (112-393)||(26074477-26074761)
chr5 (236-425)||(27502013-27502202)
chr5 (236-403)||(32487386-32487552)
chr5 (244-410)||(15370099-15370265)
chr5 (236-398)||(18603124-18603286)
chr5 (237-403)||(41170627-41170793)
chr5 (247-416)||(3295331-3295498)
chr5 (181-401)||(24489207-24489424)
chr5 (246-410)||(42405590-42405752)
chr5 (247-415)||(25327938-25328106)
chr5 (244-403)||(41632782-41632941)
chr5 (246-403)||(1028516-1028673)
chr5 (217-393)||(26074155-26074330)
chr5 (245-404)||(299490-299649)
chr5 (251-409)||(11416970-11417128)
chr5 (235-403)||(9498654-9498821)
chr5 (254-398)||(34753029-34753173)
chr5 (246-403)||(6224198-6224355)
chr5 (193-365)||(26074818-26074993)
chr5 (244-403)||(12662651-12662810)
chr5 (236-412)||(623810-623986)
chr5 (244-415)||(36568556-36568725)
chr5 (246-395)||(26075168-26075318)
chr5 (256-398)||(33747783-33747925)
chr5 (244-402)||(35150007-35150164)
chr5 (148-394)||(38427461-38427697)
chr5 (270-400)||(15370428-15370558)
chr5 (241-379)||(29549278-29549416)
chr5 (178-352)||(36521946-36522120)
chr5 (181-373)||(36522266-36522459)
chr5 (236-382)||(5723811-5723957)
chr5 (178-362)||(31509555-31509742)
chr5 (244-403)||(26590909-26591068)
chr5 (246-400)||(300961-301107)
chr5 (246-403)||(35167837-35167994)
chr5 (247-403)||(2411010-2411166)
chr5 (236-319)||(7768842-7768925)
chr5 (330-403)||(26900016-26900089)
chr5 (247-403)||(35914852-35915008)
chr5 (246-324)||(26074320-26074398)
chr5 (246-339)||(42508614-42508707)
chr5 (331-410)||(38427306-38427385)
chr5 (174-279)||(13785732-13785837)
chr5 (11-108)||(9498534-9498629)
chr5 (328-380)||(795254-795306)
chr5 (10-106)||(6500634-6500729)
chr5 (258-376)||(31509745-31509864)
chr5 (246-325)||(39309686-39309764)
chr5 (158-239)||(9498411-9498493)
chr5 (247-369)||(41635224-41635346)
chr5 (302-402)||(13785632-13785732)
chr5 (311-362)||(13042606-13042657)
chr5 (9-96)||(32487575-32487661)
chr5 (246-362)||(13786041-13786157)
chr5 (124-233)||(35150607-35150719)
chr5 (10-92)||(38427403-38427486)
chr5 (247-304)||(6225047-6225104)
chr5 (246-339)||(42524719-42524811)
chr5 (236-284)||(5660290-5660338)
chr5 (346-398)||(24489583-24489635)
chr5 (302-362)||(32445943-32446003)
chr5 (315-382)||(9498343-9498410)
chr5 (311-358)||(13112604-13112651)
chr5 (244-286)||(35150747-35150789)
chr5 (244-286)||(35151038-35151080)
chr5 (302-400)||(42435486-42435583)
chr5 (281-369)||(19275566-19275653)
chr5 (1-92)||(26074403-26074494)
chr5 (10-85)||(26075058-26075133)
chr5 (212-256)||(15370380-15370426)
chr5 (328-362)||(13042788-13042822)
chr5 (328-362)||(13112786-13112820)
chr5 (236-293)||(22298956-22299014)
[»] chr4 (110 HSPs)
chr4 (115-401)||(39404273-39404555)
chr4 (124-392)||(54108796-54109060)
chr4 (178-416)||(44620592-44620831)
chr4 (179-401)||(36629172-36629394)
chr4 (112-397)||(20826086-20826370)
chr4 (234-400)||(50630755-50630921)
chr4 (236-403)||(55933121-55933288)
chr4 (130-353)||(2740956-2741180)
chr4 (236-404)||(41370349-41370517)
chr4 (244-399)||(25483336-25483491)
chr4 (177-404)||(18932745-18932983)
chr4 (130-410)||(49076441-49076722)
chr4 (241-404)||(50002423-50002586)
chr4 (244-399)||(54017596-54017751)
chr4 (244-392)||(52884695-52884844)
chr4 (244-399)||(3340807-3340962)
chr4 (244-401)||(1731646-1731803)
chr4 (244-403)||(10245920-10246078)
chr4 (246-400)||(39792860-39793014)
chr4 (244-402)||(49076829-49076986)
chr4 (247-401)||(50459724-50459878)
chr4 (246-415)||(39404020-39404189)
chr4 (214-392)||(52884856-52885038)
chr4 (246-402)||(36572021-36572177)
chr4 (213-401)||(22027960-22028150)
chr4 (244-403)||(22183261-22183420)
chr4 (244-403)||(36608658-36608817)
chr4 (244-385)||(4955332-4955473)
chr4 (253-402)||(44621011-44621160)
chr4 (236-364)||(49880152-49880280)
chr4 (254-404)||(54343004-54343147)
chr4 (246-401)||(34646648-34646803)
chr4 (112-401)||(45489331-45489622)
chr4 (253-402)||(44620362-44620511)
chr4 (244-395)||(32941128-32941279)
chr4 (263-410)||(54936215-54936361)
chr4 (244-403)||(22028366-22028527)
chr4 (247-402)||(49302907-49303064)
chr4 (193-402)||(3244449-3244657)
chr4 (250-403)||(20825842-20825995)
chr4 (244-415)||(2740700-2740869)
chr4 (245-402)||(16888814-16888971)
chr4 (244-425)||(34004560-34004739)
chr4 (244-399)||(4390102-4390257)
chr4 (243-403)||(54108537-54108695)
chr4 (245-410)||(16889526-16889691)
chr4 (124-310)||(44621304-44621492)
chr4 (259-370)||(45496820-45496931)
chr4 (220-398)||(43174480-43174661)
chr4 (201-403)||(3341083-3341287)
chr4 (236-367)||(6975489-6975620)
chr4 (298-403)||(23817678-23817783)
chr4 (246-362)||(41707503-41707618)
chr4 (284-404)||(43827480-43827599)
chr4 (290-410)||(18879852-18879972)
chr4 (246-390)||(19504707-19504842)
chr4 (295-396)||(31691203-31691306)
chr4 (244-399)||(51768061-51768216)
chr4 (244-362)||(54741216-54741334)
chr4 (244-413)||(3700365-3700526)
chr4 (246-381)||(40067045-40067181)
chr4 (244-403)||(28034229-28034388)
chr4 (265-404)||(48111694-48111833)
chr4 (257-352)||(54017750-54017845)
chr4 (10-88)||(45496734-45496812)
chr4 (10-103)||(3340990-3341083)
chr4 (10-119)||(10246103-10246212)
chr4 (112-240)||(16889315-16889444)
chr4 (216-325)||(10246317-10246428)
chr4 (266-403)||(3271806-3271948)
chr4 (236-296)||(50788087-50788147)
chr4 (13-108)||(18933008-18933102)
chr4 (252-310)||(44620304-44620362)
chr4 (249-362)||(760194-760306)
chr4 (250-403)||(45489711-45489864)
chr4 (286-385)||(15841383-15841482)
chr4 (13-108)||(41370543-41370637)
chr4 (269-400)||(39698944-39699077)
chr4 (336-410)||(43174233-43174307)
chr4 (178-362)||(15841023-15841208)
chr4 (228-310)||(44620926-44621011)
chr4 (124-224)||(22028163-22028263)
chr4 (247-376)||(34544107-34544239)
chr4 (244-376)||(23556890-23557022)
chr4 (311-362)||(11197293-11197344)
chr4 (358-416)||(11702283-11702341)
chr4 (215-281)||(41370673-41370738)
chr4 (14-93)||(20826024-20826104)
chr4 (354-393)||(19895406-19895445)
chr4 (244-318)||(11348410-11348484)
chr4 (10-90)||(44621182-44621263)
chr4 (174-225)||(41707340-41707392)
chr4 (311-362)||(10396198-10396249)
chr4 (311-362)||(10396483-10396534)
chr4 (328-398)||(41370742-41370812)
chr4 (320-362)||(41707279-41707321)
chr4 (357-398)||(23817457-23817498)
chr4 (10-90)||(23817572-23817652)
chr4 (125-198)||(43174405-43174477)
chr4 (311-363)||(922485-922537)
chr4 (10-89)||(2740874-2740953)
chr4 (307-403)||(11783550-11783646)
chr4 (244-292)||(45050601-45050649)
chr4 (312-351)||(1868119-1868158)
chr4 (236-267)||(18933103-18933134)
chr4 (201-231)||(5882092-5882122)
chr4 (302-360)||(11706584-11706641)
chr4 (310-356)||(51681604-51681650)
chr4 (244-285)||(11706636-11706677)
chr4 (369-410)||(45496675-45496716)
[»] scaffold0391 (5 HSPs)
scaffold0391 (112-403)||(1105-1398)
scaffold0391 (136-295)||(3092-3254)
scaffold0391 (291-362)||(1731-1802)
scaffold0391 (10-90)||(1383-1464)
scaffold0391 (129-238)||(1464-1575)
[»] scaffold0702 (3 HSPs)
scaffold0702 (177-413)||(136-367)
scaffold0702 (246-404)||(512-670)
scaffold0702 (10-108)||(392-489)
[»] scaffold0078 (3 HSPs)
scaffold0078 (158-364)||(5268-5477)
scaffold0078 (244-395)||(4982-5133)
scaffold0078 (60-108)||(5214-5262)
[»] scaffold0171 (1 HSPs)
scaffold0171 (197-360)||(17496-17663)
[»] scaffold0027 (1 HSPs)
scaffold0027 (244-403)||(47360-47519)
[»] scaffold0113 (2 HSPs)
scaffold0113 (178-369)||(39771-39963)
scaffold0113 (246-376)||(39459-39588)
[»] scaffold0504 (1 HSPs)
scaffold0504 (246-321)||(10192-10267)


Alignment Details
Target: chr6 (Bit Score: 412; Significance: 0; HSPs: 64)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 10 - 425
Target Start/End: Original strand, 29518686 - 29519101
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgta 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29518686 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgta 29518785  T
110 cggcaacggcagtgcaagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29518786 cggcaacggcagtgcaagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaa 29518885  T
210 ttgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaaga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29518886 ttgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaaga 29518985  T
310 ggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctc 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29518986 ggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctc 29519085  T
410 ctctcataaccaaaca 425  Q
    ||||||||||| ||||    
29519086 ctctcataacccaaca 29519101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 236 - 425
Target Start/End: Original strand, 29518495 - 29518684
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29518495 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 29518594  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataaccaaaca 425  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
29518595 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataacccaaca 29518684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 236 - 425
Target Start/End: Original strand, 32741171 - 32741360
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32741171 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 32741270  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataaccaaaca 425  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32741271 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataacccaaca 32741360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 182; E-Value: 6e-98
Query Start/End: Original strand, 177 - 413
Target Start/End: Original strand, 2378059 - 2378295
Alignment:
177 taagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggat 275  Q
    ||||||||||||||||| ||||||||| |||||||  ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||    
2378059 taagagcttccgcttgaagggggagcatgatgaataaatggactcacatttg-gggggagtgttggtttgcaagtgtgagttatatgtcccacatcggat 2378157  T
276 aaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggtt 375  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| | ||||    
2378158 aaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttaggtaagaatgtggtgtctctcttgcttgagtggtt 2378257  T
376 gttctagcctcgatgtggacggtcccccgcgctcctct 413  Q
    ||||||||||||||||||||||||||||| ||| ||||    
2378258 gttctagcctcgatgtggacggtcccccgagcttctct 2378295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 165; E-Value: 8e-88
Query Start/End: Original strand, 195 - 403
Target Start/End: Original strand, 3409611 - 3409819
Alignment:
195 ggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaac 294  Q
    |||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||    
3409611 ggggagcacgttaaagtgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtaccacatcagataaaatagtaaaagttgaac 3409710  T
295 accttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
    | |||||||||||||||||||||||||||||| |||| |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3409711 atcttataagtaagaggacccataaacccattgcctttattttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3409810  T
395 cggtccccc 403  Q
    |||||||||    
3409811 cggtccccc 3409819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 178 - 418
Target Start/End: Original strand, 16454838 - 16455081
Alignment:
178 aagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcgga 274  Q
    |||||||||||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||| | ||  ||| |||||||||| ||||||||||| ||    
16454838 aagagcttccgcttgaagggggagcatgctgaattgatggagtcacagttgagggggagtgttgttgtgtacaaatgtgagttatgtgtcccacatcaga 16454937  T
275 taaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggt 374  Q
    ||||| ||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||    
16454938 taaaagagtaaaggttgaacaccttataagtaataggacccataaacctattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggt 16455037  T
375 tgttctagcctcgatgtggacggtcccccgcgctcctctcataa 418  Q
    |||||||||||||||||||||||||||||| ||||| |||||||    
16455038 tgttctagcctcgatgtggacggtcccccgagctcccctcataa 16455081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 156; E-Value: 2e-82
Query Start/End: Original strand, 125 - 403
Target Start/End: Complemental strand, 2578730 - 2578442
Alignment:
125 aagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttg---------aggggg-agcacgatgaattgat 214  Q
    |||||||||||||| ||||| |||||||||| |||||| || ||| |||| ||||||||||||||||          |||| | |||| ||||||| |||    
2578730 aagcagtgtcggtctgtttgcggagaaaccaacaacggcgatacaagcaa-gtaagagcttccgcttccgcttgaaaagggagcagcatgatgaatagat 2578632  T
215 ggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagagga 312  Q
    |||||||||||||||||||||||||| | ||  |||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||    
2578631 ggactcacacttgagggggagtgttgttgtgtacaagtgtgagttatatgtcccaca-cggataaaagagtaaaggttgaacactttataagtaagagga 2578533  T
313 cccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
2578532 cccataaacccatagccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtccccc 2578442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 150; E-Value: 7e-79
Query Start/End: Original strand, 174 - 402
Target Start/End: Complemental strand, 10074219 - 10073991
Alignment:
174 aagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcg 272  Q
    |||||||||||||||||||| ||||||||| ||||||||||| ||||| ||||||||||||||||||| | |||||| ||||||||||| ||||||||||    
10074219 aagtaagagcttccgcttgaagggggagcatgatgaattgatagactcgcacttgagggggagtgttg-tgtgcaagggtgagttatatatcccacatcg 10074121  T
273 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcg 372  Q
    |||| || |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |  |    
10074120 gatagaaaagtaaacgttgaacaccttataagtaagaggacccataaacccattgccttaaggttttgggtaaaagtgtggtgtctctctcgcttatttg 10074021  T
373 gttgttctagcctcgatgtggacggtcccc 402  Q
    |||||||||||||||| |||||||||||||    
10074020 gttgttctagcctcgacgtggacggtcccc 10073991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 145; E-Value: 7e-76
Query Start/End: Original strand, 236 - 392
Target Start/End: Original strand, 3409251 - 3409407
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||    
3409251 tgttggtttgcaagtgtgagttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaactcattgccttaagg 3409350  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3409351 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 3409407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 143; E-Value: 1e-74
Query Start/End: Original strand, 125 - 401
Target Start/End: Original strand, 16107943 - 16108208
Alignment:
125 aagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaattgatggactcacac 224  Q
    |||||||||||||| ||||| | ||||||||||||||| ||  || | ||||||||||||||||||||| |||||||| |||||||||||||||||||||    
16107943 aagcagtgtcggtctgtttgcgaagaaaccagcaacggcgatgcaag-aaagtaagagcttccgcttgaaggggagcatgatgaattgatggactcacac 16108041  T
225 ttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacc 322  Q
    |||||||||||||||| | ||  |||||||||||||||||| ||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||    
16108042 ttgagggggagtgttgttgtgtacaagtgtgagttatatgttccacatcagataaaagagtaaatgttgaacaccttataagtaagaggacccataaacc 16108141  T
323 cattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccc 401  Q
    |||| ||||||||            ||||||||||||||||||||||| ||||||| || |||||||||||||||||||    
16108142 cattgccttaagg------------gtgtggtgtctctcttgcttgtggggttgttataacctcgatgtggacggtccc 16108208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 143; E-Value: 1e-74
Query Start/End: Original strand, 236 - 402
Target Start/End: Original strand, 35210196 - 35210362
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||    
35210196 tgttggtttgcaagtgtgagttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaaaccattgccttaagg 35210295  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    ||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||    
35210296 ttttgggtaagagtgtggtgtttcttttgcttgtgcggttgctctagcctcgatgtggacggtcccc 35210362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 139; E-Value: 3e-72
Query Start/End: Original strand, 129 - 394
Target Start/End: Complemental strand, 2579765 - 2579500
Alignment:
129 agtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttg 227  Q
    |||| |||||| |||| |||||||||| |||| |||| |||  |||||||||||||| ||||||| |||||| || ||||||| || |||||||||||||    
2579765 agtgacggtccatttgcggagaaaccaacaacagagatacaaacaaagtaagagctttcgcttgaagggggaccatgatgaatagacggactcacacttg 2579666  T
228 agggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccatta 327  Q
    |||| |||||||| || ||| |||||||||||||||||||||||||| |||| ||||||||| | | ||||||||||||||||| ||||||||| ||||     
2579665 agggagagtgttg-ttagcaggtgtgagttatatgtcccacatcggacaaaaaagtaaaggtcggataccttataagtaagagggcccataaactcattg 2579567  T
328 ccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
    |||||||||||||||||| ||| |||||||||||||||||||| |||||||||| ||||||||||||    
2579566 ccttaaggttttgggtaaaagtatggtgtctctcttgcttgtgtggttgttctaacctcgatgtgga 2579500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 136; E-Value: 2e-70
Query Start/End: Original strand, 204 - 403
Target Start/End: Complemental strand, 10074560 - 10074362
Alignment:
204 gatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataa 303  Q
    ||||||||||||||||||||||| ||||||||||||| | ||||||||||||||| | ||||||||||||||| || |||||||||||||||||||||||    
10074560 gatgaattgatggactcacacttaagggggagtgttg-tgtgcaagtgtgagttagaggtcccacatcggatagaaaagtaaaggttgaacaccttataa 10074462  T
304 gtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||  || ||| |||||||||||||||||||||||  |||||||    
10074461 gtaagaggacccataaactcattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcctcgatgtggatagtccccc 10074362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 236 - 410
Target Start/End: Complemental strand, 14748504 - 14748334
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| | ||||||    
14748504 tgttgatttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataaataagaggacccataaactcattgcgttaagg 14748405  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    ||||||||||||||||||    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
14748404 ttttgggtaagagtgtgg----tctcttgcttgtgtggttgttctagcctcgatgtggacggtcccccgcgctcc 14748334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 237 - 404
Target Start/End: Original strand, 1846741 - 1846908
Alignment:
237 gttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggt 336  Q
    ||||| |||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||    
1846741 gttgggttgcaagtgtgaattctatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagagcacccataaatccattgccttaaggt 1846840  T
337 tttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccg 404  Q
    ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
1846841 tttggataagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtcccccg 1846908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 236 - 403
Target Start/End: Original strand, 3058218 - 3058385
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||    
3058218 tgttggtttgcaagtgttagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtatgaggatccataaacccattgccttaagg 3058317  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    ||||||||||||||||||||||||||||||||||  ||| |||||| ||||||||||||| |||||||    
3058318 ttttgggtaagagtgtggtgtctctcttgcttgtagggtggttctaacctcgatgtggaccgtccccc 3058385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 235 - 403
Target Start/End: Original strand, 3415449 - 3415619
Alignment:
235 gtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaag 334  Q
    |||||||||||| ||||||||||||||||||||||||  |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||    
3415449 gtgttggtttgcgagtgtgagttatatgtcccacatcacataaaatagtaaaggttgaacaccatataagtaagaggacccataaacccattgccttaag 3415548  T
335 gttttgggtaagagtgtggtgtctctcttgcttgtgcggttgt--tctagcctcgatgtggacggtccccc 403  Q
    ||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||||||    
3415549 gtttttggtaagagtgtggtgtctctcttgcttgtgcggttgttctctagcctcgatgtggaaggtccccc 3415619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 244 - 402
Target Start/End: Complemental strand, 2580030 - 2579872
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||   ||||||||||||||||    
2580030 tgcaagtgtgagttatatgtcccacatcggataaaagagtaaaggttgaacacattataagtaagaggacccataaacccacagccttaaggttttgggt 2579931  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||    
2579930 aagaatgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggaaggtcccc 2579872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 125 - 402
Target Start/End: Complemental strand, 2579387 - 2579109
Alignment:
125 aagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgag-ggggagcac---gatgaattgatggactc 220  Q
    |||| ||||||||| |||||  |||||||||||||||| || |||  ||| ||||||||||||||||||  ||||||||    ||||||| |||||||||    
2579387 aagcggtgtcggtctgtttgcagagaaaccagcaacggcgatacaaacaa-gtaagagcttccgcttgaaaggggagcaacatgatgaatagatggactc 2579289  T
221 acacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccata 318  Q
    |||||||||||||||||||| | ||  ||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||    |||| |||||    
2579288 acacttgagggggagtgttgttgtgtacaagtgttagttatatgtcccacatcggataaaagagtaaaagttgaacaccttataag----aggaaccata 2579193  T
319 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    ||||||| || |||||| ||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||    
2579192 aacccataactttaaggctttggctaagagtgtggtgtctctcttgctcgtgtggttgttctagcctcgatgtgcacggtcccc 2579109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 130 - 400
Target Start/End: Complemental strand, 10073884 - 10073618
Alignment:
130 gtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttga 228  Q
    ||||||||||||| | |||||||||| |||| | || ||| | ||||||||| ||||||||||| |||||| || ||||||||||||||||||||||| |    
10073884 gtgtcggtccgtt-gcggagaaaccatcaacagtgatacaag-aaagtaagaccttccgcttgaagggggaacatgatgaattgatggactcacacttaa 10073787  T
229 gggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattac 328  Q
    | ||| |||||| | ||||||||| ||||||||||||||||||||| ||||  ||||||||||||||||||||||||||||||| |||||||| ||||      
10073786 gagggggtgttg-tgtgcaagtgttagttatatgtcccacatcggagaaaa--gtaaaggttgaacaccttataagtaagaggatccataaactcattgg 10073690  T
329 cttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcc 400  Q
    |||||| |||||||||||||||||||||||||||  || ||| |||||||||||| ||||||||||||||||    
10073689 cttaagattttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcatcgatgtggacggtcc 10073618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 246 - 404
Target Start/End: Original strand, 2377756 - 2377914
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
2377756 caagtgtgagttatatgtcccacatcggttaaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgccttaaggttttgggtaa 2377855  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccg 404  Q
    ||||||||||||| ||||||||| | |||| |||||||||||||||||| |||||||||    
2377856 gagtgtggtgtctttcttgcttgagtggtttttctagcctcgatgtggaaggtcccccg 2377914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 125; E-Value: 6e-64
Query Start/End: Original strand, 246 - 410
Target Start/End: Original strand, 16454577 - 16454741
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    |||||||||||||| ||||||||||| ||||||| | |||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||    
16454577 caagtgtgagttatgtgtcccacatcagataaaagaataaaagttgaacaccttataagtaagaggacccataaacccattgccttaagattttggataa 16454676  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
16454677 gagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgagctcc 16454741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 125; E-Value: 6e-64
Query Start/End: Original strand, 236 - 392
Target Start/End: Original strand, 26544041 - 26544197
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||   ||||||||    
26544041 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacacgttataagtaagaggacccataaacccaccgccttaagg 26544140  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    ||||| ||||||||||| ||||||||||||||||||| ||||||||||||| |||||    
26544141 ttttgagtaagagtgtgatgtctctcttgcttgtgcgattgttctagcctcaatgtg 26544197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 120; E-Value: 6e-61
Query Start/End: Original strand, 246 - 393
Target Start/End: Original strand, 16107680 - 16107827
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||||||  |||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||    
16107680 caagtgtgagttatatgtgtcacatcggataaaaaagtaaaggttaaacaccttataagtaagaggactcataaacccattgccttaaggttttgggtaa 16107779  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgg 393  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||    
16107780 gagtgtggtgtctctcttgcttgtgcggttgctctagcctcgatgtgg 16107827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 236 - 402
Target Start/End: Original strand, 1127352 - 1127518
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    ||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1127352 tgttggtttgcaactgtgagttatatatcccacatcgggtaaaatagtaaaggttgaacaccttataagtaagaggactcataaacccattaccttaagg 1127451  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |||||||||||||||||| ||||||||| ||| || ||||| |||| |||||||||||  |||||||    
1127452 ttttgggtaagagtgtggcgtctctcttacttatgtggttgctctaacctcgatgtgggtggtcccc 1127518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 219 - 416
Target Start/End: Complemental strand, 2579016 - 2578821
Alignment:
219 tcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccata 318  Q
    |||||||||||||||||||||| |  |||||||||| ||||||||||| |||||||||||| |||||| |||||| ||||||||| |||||||| |||||    
2579016 tcacacttgagggggagtgttg-tgagcaagtgtgatttatatgtccctcatcggataaaa-agtaaatgttgaataccttataaataagaggatccata 2578919  T
319 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcat 416  Q
    ||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||  |||||||||||||||||||||  ||||| |||||    
2578918 aactcattaccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgtggttgttctgacctcgatgtggacggtcccccaggctcccctcat 2578821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 250 - 403
Target Start/End: Original strand, 2843560 - 2843714
Alignment:
250 tgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggaccc-ataaacccattaccttaaggttttgggtaagag 348  Q
    ||||||||||||||  |||||||||||||||| |||| |||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||    
2843560 tgtgagttatatgtttcacatcggataaaataataaaagttgaacaccttataagtaagaggaccccataaactcattgccttaaggttttgggtaagag 2843659  T
349 tgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||| ||||||||||||| | ||||||||||||||||||||||||||||||||    
2843660 tgtggtatctctcttgcttgagtggttgttctagcctcgatgtggacggtccccc 2843714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 244 - 415
Target Start/End: Complemental strand, 593867 - 593694
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| | | ||||||||||||||||    
593867 tgcaagtgtgagttgtatgtcccacatcggataaaagagtaaaggttgaacaccttataagtaagaggactcataaaccgactgccttaaggttttgggt 593768  T
344 aagagtgtgg--tgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctca 415  Q
    || |||||||  | |||||||| ||||| |||||||||||| |||||||| |||||||||||| ||||| ||||    
593767 aatagtgtggtatctctctcttacttgtacggttgttctaggctcgatgttgacggtcccccgagctcccctca 593694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 105; E-Value: 5e-52
Query Start/End: Original strand, 246 - 402
Target Start/End: Complemental strand, 5832182 - 5832027
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |||   ||||||| ||||||||||    
5832182 caagtgtaagttatatgtcccacattggataaaagagtaaaggttgaacaccttataagtaagaggacccataaagcca-ccccttaagattttgggtaa 5832084  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
     ||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||    
5832083 aagtgtggtgtctctcttacttgtgtggttgttctagcctcgatgtagacggtcccc 5832027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 247 - 387
Target Start/End: Complemental strand, 1950340 - 1950200
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaag 346  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||| | | | ||||||||||||| |||||    
1950340 aagtgtgagttatatgtcccacatcggataaaagagtaaaggttgaacaccttacaagtaagaggagccataaatctaatgccttaaggttttgagtaag 1950241  T
347 agtgtggtgtctctcttgcttgtgcggttgttctagcctcg 387  Q
    ||||||  ||||||||| |||||||||||||||||||||||    
1950240 agtgtgacgtctctcttacttgtgcggttgttctagcctcg 1950200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 247 - 399
Target Start/End: Complemental strand, 6999951 - 6999799
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaag 346  Q
    ||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| ||||||||| |||||||| || | |||||||||||||| ||||    
6999951 aagtgtgagttatatgtcctacatcggataaaaaagtaaaagttgaacaccttatatgtaagaggatccataaactcactgccttaaggttttggataag 6999852  T
347 agtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtc 399  Q
    ||||||| ||||||||||||  || ||||||||||| ||||||||||||||||    
6999851 agtgtggcgtctctcttgctaatgtggttgttctagtctcgatgtggacggtc 6999799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 249 - 352
Target Start/End: Complemental strand, 32460733 - 32460630
Alignment:
249 gtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagag 348  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
32460733 gtgtgagttatatgtcccacatcgtataaaatagtaaaggttgaacaccttataagtaagaggactcataaacccattgccttaaggttttgggtaagag 32460634  T
349 tgtg 352  Q
    ||||    
32460633 tgtg 32460630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 244 - 398
Target Start/End: Original strand, 10911565 - 10911720
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaata-gtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttggg 342  Q
    |||||||||||||||||||||| ||||| ||||||| | |||||||||||||||||||||||||||||||| ||||||| |||| |||||| ||||||      
10911565 tgcaagtgtgagttatatgtcctacatcagataaaaaaagtaaaggttgaacaccttataagtaagaggactcataaactcattgccttaaagttttgaa 10911664  T
343 taagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggt 398  Q
    |||||||||| |||||||||| ||  ||  ||||||| ||||||||||||||||||    
10911665 taagagtgtgatgtctctcttactaatgttgttgttcaagcctcgatgtggacggt 10911720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 178 - 369
Target Start/End: Original strand, 6071064 - 6071257
Alignment:
178 aagagcttccgcttgagggg-gagcacgatgaattgatggactcacacttgagggggag--tgttggtttgcaagtgtgagttatatgtcccacatcgga 274  Q
    ||||||||||| || ||||| ||||| |||||||||||||||||||| |||||||| ||  ||||| | ||||||||||||||||||||||||||| | |    
6071064 aagagcttccgtttaaggggtgagcatgatgaattgatggactcacatttgaggggaagattgttg-tgtgcaagtgtgagttatatgtcccacattgaa 6071162  T
275 taaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgt 369  Q
    || || |||  ||||||||||| |||||||| ||| || |||||||| |||| ||||||| |||||| ||||||||||| |||||||| ||||||    
6071163 tagaaaagtggaggttgaacactttataagtgagatgatccataaactcattgccttaagattttggataagagtgtggcgtctctctcgcttgt 6071257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 250 - 369
Target Start/End: Complemental strand, 9062501 - 9062383
Alignment:
250 tgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagt 349  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||  ||||| ||||||||||| |||    
9062501 tgtgagttatatgtcccacatcggataaaatagtaaaggttgaacatcttataagtaagaggactcataaactcattgtcttaa-gttttgggtaaaagt 9062403  T
350 gtggtgtctctcttgcttgt 369  Q
    ||||| |||||||| |||||    
9062402 gtggtatctctcttacttgt 9062383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 206 - 363
Target Start/End: Original strand, 8481888 - 8482045
Alignment:
206 tgaattgatggactcacacttgagggggag--tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataa 303  Q
    ||||||||||||||||||||||||||||||  ||||| | |||||||||||||||||||||| ||||| |||| || |||  ||||||||||| ||||||    
8481888 tgaattgatggactcacacttgagggggagattgttg-tgtgcaagtgtgagttatatgtcc-acatcagatataaaagtggaggttgaacactttataa 8481985  T
304 gtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctctt 363  Q
     | ||| ||| ||||||| |||| ||||||| ||||||||||||||||||||||||||||    
8481986 atgagatgactcataaactcattgccttaagattttgggtaagagtgtggtgtctctctt 8482045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 10074336 - 10074240
Alignment:
12 gtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||||||||||||| ||||||| |||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||    
10074336 gtatcagagccccggttcgaagaagggtacgaccgaggccgccggtcagttgcgcagaaagtagcaacgacggtacaagcagcaagtggctcattgt 10074240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 244 - 402
Target Start/End: Complemental strand, 12071849 - 12071691
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||| | |||| |||| || | |  || |||||||| ||||||   | ||||| |||||||| || |||||||||||||||||    
12071849 tgcaagtgtgagttatatgtctcgcatcagatagaaaaatggagtttgaacactttataatagaaaggactcataaacctatgaccttaaggttttgggt 12071750  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |||||||||| ||||||||  |||||| ||||||||||||||||||||| |||||||||    
12071749 aagagtgtggcgtctctctcacttgtgtggttgttctagcctcgatgtgaacggtcccc 12071691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 244 - 402
Target Start/End: Complemental strand, 12092640 - 12092482
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||| ||| |||| ||||||||||||||||| || |||  ||||||| ||| |||||||| |||||| |||||||| |||| ||||||||||||| ||    
12092640 tgcaagggtgtgttagatgtcccacatcggatagaaaagtggaggttgagcactttataagtgagaggatccataaactcattgccttaaggttttgagt 12092541  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |||| ||||||||||||||  |||||| ||||| ||| |||| |||||||  |||||||    
12092540 aagactgtggtgtctctctcacttgtgaggttgctctggcctggatgtgggtggtcccc 12092482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 239 - 396
Target Start/End: Complemental strand, 5958766 - 5958613
Alignment:
239 tggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttt 338  Q
    |||| ||||| ||||||||||||||   ||||||||||||| ||||||||||||||||||||||| |||||| || ||||||| ||||  ||||| ||||    
5958766 tggtgtgcaattgtgagttatatgtgttacatcggataaaacagtaaaggttgaacaccttataaataagagaactcataaactcattgtcttaaagttt 5958667  T
339 tgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacg 396  Q
    ||||  |||||||| |||||||||||    || | |||||||| ||||||||||||||    
5958666 tgggatagagtgtgatgtctctcttg----tgtgattgttctaacctcgatgtggacg 5958613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 146 - 303
Target Start/End: Original strand, 33605879 - 33606034
Alignment:
146 ggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaattgatggactcacacttgagggggagtgttggtttg 245  Q
    ||||||||||||||||  || ||| |||| ||||||||||||||| || |  | ||||| |||||||||||||||||||||||||||||||| | || ||    
33605879 ggagaaaccagcaacgacgatacaagcaa-gtaagagcttccgctcgaagaagggcacggtgaattgatggactcacacttgagggggagtgat-gtgtg 33605976  T
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataa 303  Q
    ||| ||| ||||||||||||||||||| ||| || |||  ||||||||||| ||||||    
33605977 caaatgtaagttatatgtcccacatcgaatagaaaagtggaggttgaacactttataa 33606034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 244 - 399
Target Start/End: Complemental strand, 12085191 - 12085037
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||||  |||| |||| || |||  || |||||||| ||||||   | ||||| |||||| ||||  ||||||||||||||||    
12085191 tgcaagtgtgagttatatgtcctgcatcagatagaa-agtggagtttgaacactttataatagaaaggactcataaaaccatggccttaaggttttgggt 12085093  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtc 399  Q
    |||||||||| ||||||||  |||||| ||||||||||||||||||| | ||||||    
12085092 aagagtgtggcgtctctctcacttgtgtggttgttctagcctcgatgcgaacggtc 12085037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 204 - 317
Target Start/End: Original strand, 35210449 - 35210551
Alignment:
204 gatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataa 303  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||| ||||| |||    
35210449 gatggattgatggactcacacttgagggggagtgttggtttgcaagtgc-----------cccacatcggataaaatagtaaaggttgaataccttgtaa 35210537  T
304 gtaagaggacccat 317  Q
    ||||||||||||||    
35210538 gtaagaggacccat 35210551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 174 - 360
Target Start/End: Original strand, 2975482 - 2975668
Alignment:
174 aagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttg-gtttgcaagtgtgagttat-atgtcccacat 270  Q
    |||||||||||||||||| | |||||| || ||||||| |||| ||||||||||| |||||||||||| ||||  |||||| ||| || |||||||||||    
2975482 aagtaagagcttccgcttaaagggggaacatgatgaatagatgcactcacacttg-gggggagtgttgtgttt--aagtgtaagtaattatgtcccacat 2975578  T
271 cggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctct 360  Q
    |  ||| || |||||| ||||||||||||||||| |||| |||||||||| || ||  ||||| ||||||  |||||||||| |||||||    
2975579 caaatagaaaagtaaatgttgaacaccttataagcaagatgacccataaatcctttgtcttaaagttttgaataagagtgtgatgtctct 2975668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 248 - 403
Target Start/End: Complemental strand, 17135223 - 17135068
Alignment:
248 agtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaaga 347  Q
    ||||||||||||||||| ||||||||||| |  |||||| ||| || |||||||||| |||||||  ||||||| ||||     || ||||||| |||||    
17135223 agtgtgagttatatgtctcacatcggatagagaagtaaatgtttaataccttataagcaagaggattcataaactcattgttagaaagttttggataaga 17135124  T
348 gtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||  | |||| | ||||||||||||||||  |||| |||||||||||||||||    
17135123 gtgtgacggctctttcgcttgtgcggttgttccggccttgatgtggacggtccccc 17135068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 244 - 399
Target Start/End: Original strand, 31714671 - 31714823
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||| | |||||||| |||||||||| || |||  |||||||||    ||||| | ||||||||||| ||| |||| ||||||||||||| ||    
31714671 tgcaagtgtgact-atatgtcctacatcggatagaaaagtggaggttgaacgttatataa-tgagaggacccattaactcattgccttaaggttttgagt 31714768  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtc 399  Q
    |||||||||| || | | | ||||||| ||||| ||||||||||||||||||||||    
31714769 aagagtgtggcgt-tttttcgcttgtgtggttgctctagcctcgatgtggacggtc 31714823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 3409470 - 3409567
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||||||||||||||||||||  |  ||||||| | ||||||  |||||| | |||||||||||| ||||||||| |||||||||||||||||    
3409470 tggtatcagagccccggttcgacgaagtatatgaccgaggcagccggtc-gttgcgtaaaaagcagcaacggcggtacaagtagcaagtggctccttgt 3409567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 2579467 - 2579387
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggt-tagttgcgcagaaagcagcaacgacggtacaa 89  Q
    |||||||||||||||||||||||||| ||| |||||||| | ||||||  | |||||||||||||||||||| ||||||||    
2579467 tggtatcagagccccggttcgacgaacggtacgaccgaggcagccggtccacttgcgcagaaagcagcaacggcggtacaa 2579387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 26544230 - 26544321
Alignment:
8 actggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtgg 100  Q
    |||||||| ||||||||||||||| |||||||||||||||| | ||||| || ||||| ||||||| ||||||  ||||||| ||||||||||    
26544230 actggtattagagccccggttcgatgaagggtgcgaccgaggcagccgg-tatttgcgtagaaagccgcaacgctggtacaaacagcaagtgg 26544321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 348 - 395
Target Start/End: Original strand, 3409405 - 3409452
Alignment:
348 gtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 395  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||    
3409405 gtgtggtgtctctcttgcttatgcggttgttctagcctcgatgtggac 3409452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 2377937 - 2378034
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||||||||||||||||||||||||| ||||||   | ||| | |||||| ||||||  |||||  | |||||||||||||||||||||||||    
2377937 tggtatcagagccccggttcgacgaagggtgcaaccgaggtagtcgg-tcgttgcgaagaaagtcgcaacagcagtacaagcagcaagtggctccttgt 2378034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 2578810 - 2578730
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttag-ttgcgcagaaagcagcaacgacggtacaa 89  Q
    |||||||||||||||||||||||||||||| |||||||| | ||||||  | ||| |||||||||||||||| || |||||    
2578810 tggtatcagagccccggttcgacgaagggtacgaccgaggcagccggtccgcttgggcagaaagcagcaacggcgttacaa 2578730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 16107863 - 16107943
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggt-tagttgcgcagaaagcagcaacgacggtacaa 89  Q
    ||||||||||||||||||||||||||||||  ||||||| | ||||||  | ||| |||||||||||||||| ||||||||    
16107863 tggtatcagagccccggttcgacgaagggtatgaccgaggcagccggtccatttgtgcagaaagcagcaacggcggtacaa 16107943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 235
Target Start/End: Complemental strand, 12092261 - 12092201
Alignment:
178 aagagcttccgcttgaggggg---agcacgatgaattgatggactcacacttgagggggag 235  Q
    ||||||||||||| |||||||   |||| ||||||||||||||||||||||||||||||||    
12092261 aagagcttccgctagaggggggtgagcatgatgaattgatggactcacacttgagggggag 12092201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 2579848 - 2579779
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttag-ttgcgcagaaagcagcaa 78  Q
    |||||||||||||||||||| ||||||||| |||||||| | ||| ||| | ||||||||||||||||||    
2579848 tggtatcagagccccggttccacgaagggtacgaccgaggcagccagttcgtttgcgcagaaagcagcaa 2579779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 281 - 322
Target Start/End: Complemental strand, 14789325 - 14789284
Alignment:
281 agtaaaggttgaacaccttataagtaagaggacccataaacc 322  Q
    |||||||||||||||||||| |||||||||||||||||||||    
14789325 agtaaaggttgaacaccttacaagtaagaggacccataaacc 14789284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 16454758 - 16454838
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttag-ttgcgcagaaagcagcaacgacggtacaa 89  Q
    |||||||||||||| ||||||||||||||| ||||||||    |||||  | |||||||||||||| ||||||||||||||    
16454758 tggtatcagagcccaggttcgacgaagggtacgaccgaggtaaccggtccgtttgcgcagaaagcaacaacgacggtacaa 16454838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 22605345 - 22605301
Alignment:
312 acccataaacccattaccttaaggttttgggtaagagtgtggtgt 356  Q
    ||||||||||||||| |||||||||||||||||||| ||||||||    
22605345 acccataaacccattgccttaaggttttgggtaagaatgtggtgt 22605301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 312 - 363
Target Start/End: Complemental strand, 11637811 - 11637760
Alignment:
312 acccataaacccattaccttaaggttttgggtaagagtgtggtgtctctctt 363  Q
    |||||||||||||||  |||||| |||||| |||||||||||||||||||||    
11637811 acccataaacccattgtcttaagattttggataagagtgtggtgtctctctt 11637760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 14789441 - 14789403
Alignment:
70 aagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    ||||||||||||||||| |||||||||||||||||||||    
14789441 aagcagcaacgacggtaaaagcagcaagtggctccttgt 14789403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 372 - 416
Target Start/End: Original strand, 2975033 - 2975077
Alignment:
372 ggttgttctagcctcgatgtggacggtcccccgcgctcctctcat 416  Q
    ||||||||||||||||||||||  |||||| ||||||||||||||    
2975033 ggttgttctagcctcgatgtggcaggtcccacgcgctcctctcat 2975077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 312 - 356
Target Start/End: Complemental strand, 21130147 - 21130103
Alignment:
312 acccataaacccattaccttaaggttttgggtaagagtgtggtgt 356  Q
    ||||||||| ||||| |||||||||||||| ||||||||||||||    
21130147 acccataaatccattgccttaaggttttggataagagtgtggtgt 21130103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 336 - 394
Target Start/End: Complemental strand, 10902496 - 10902438
Alignment:
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
    |||||||||||||||||||||||||||  |||||  |||||||||  ||| ||||||||    
10902496 ttttgggtaagagtgtggtgtctctctcacttgtatggttgttctgacctagatgtgga 10902438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 251 - 385
Target Start/End: Complemental strand, 30618766 - 30618634
Alignment:
251 gtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtg 350  Q
    |||||||| | |||| ||||||| | ||| |||  ||| ||||||| |||||||||||| |||| |||||||  ||  ||||||||| ||||||| | ||    
30618766 gtgagttagaagtcctacatcggttgaaaaagtggaggatgaacactttataagtaagatgacc-ataaaccg-ttgtcttaaggttatgggtaaaaatg 30618669  T
351 tggtgtctctcttgcttgtgcggttgttctagcct 385  Q
    ||||||||||||| ||| || ||||| ||| ||||    
30618668 tggtgtctctcttacttatgtggttgctcttgcct 30618634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 332; Significance: 0; HSPs: 85)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 426 - 778
Target Start/End: Original strand, 2291993 - 2292345
Alignment:
426 tgttataggtgtgaatcattttatcgtggcggctcaacacatcttaggaaggtgtacttaactttaagtagtagttatagttataataagaagaattgga 525  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2291993 tgttataggtgtgaatcattttatcgtggcggctcaacacatcttaggaaggtgtacttaactttaagtagtagttatagttataataagaagaattgga 2292092  T
526 tgttatgtgaatgggcgtgtaccattatttaatttggtggtacaatgcaactcaggacgacgttcctaaatgtgtgaataagcgtgtaacatttaatcct 625  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2292093 tgttatgtgaatgggcgtgtaccattatttaatttggtggtacaatgcaactcaggacgacgttcctaaatgtgtgaataagcgtgtaacatttaatcct 2292192  T
626 tgtgtttcaatgcaagtaagtagtttagtttagagcaattagaacaattggattatgtgtccctctttgtgtccaacgagaacatttatgcttatgcggc 725  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2292193 tgtgtttcaatgcaagtaagtagtttagtttagagcaattagaacaattggattatgtgtccctctttgtgtccaacgagaacatttatgcttatgcggc 2292292  T
726 atgttgagtcatcannnnnnnaattatatgacatgttcatcgtgtaattatta 778  Q
    ||||||||||||||       ||||||||||||||||||||||||||||||||    
2292293 atgttgagtcatcatttttttaattatatgacatgttcatcgtgtaattatta 2292345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 158 - 398
Target Start/End: Original strand, 3669973 - 3670214
Alignment:
158 aacggagacacatgcaaagtaagagcttccgcttgagggg-gagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagt 256  Q
    ||||| || |||||||||||||||||||| |||||| ||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||    
3669973 aacggcgatacatgcaaagtaagagcttctgcttgaagggtgagcatgatgaattgatggactcacacttgagggggactgttggtttgcaagtgtgagt 3670072  T
257 tatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgt 356  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||    
3670073 tatatgtcccacatcggataaaatagtaaaggtttaacaccttataagtatgaggacccataaacctatttccttaaggttttgggtaagagtgtggtgt 3670172  T
357 ctctcttgcttgtgcggttgttctagcctcgatgtggacggt 398  Q
    ||||||||||||||||||||||||||||||||||||||||||    
3670173 ctctcttgcttgtgcggttgttctagcctcgatgtggacggt 3670214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 167 - 394
Target Start/End: Complemental strand, 1014107 - 1013879
Alignment:
167 acatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcc 265  Q
    ||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
1014107 acatgcaaagtaagagcttccgcttgaagggggagtatgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgttc 1014008  T
266 cacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgc 365  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||| |||||  |||||| ||||||||||| ||||||| || |    
1014007 cacatcggataaaatagtaaaagttgaacaccctataagtaagaggaccaataaacccattgccttagagttttgagtaagagtgtgttgtctcttttac 1013908  T
366 ttgtgcggttgttctagcctcgatgtgga 394  Q
    |||||||||||||||||||||||||||||    
1013907 ttgtgcggttgttctagcctcgatgtgga 1013879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 159; E-Value: 3e-84
Query Start/End: Original strand, 131 - 400
Target Start/End: Original strand, 40518470 - 40518738
Alignment:
131 tgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgaggggg-agcacgatgaattgatggactcacacttgag 229  Q
    |||||||||||||| ||||||||||||||||  || ||| |||| |||||||||||| |||||||||| |||| ||||||||||||||||||||||||||    
40518470 tgtcggtccgtttgcggagaaaccagcaacgacgatacaagcaa-gtaagagcttccacttgaggggggagcatgatgaattgatggactcacacttgag 40518568  T
230 ggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattacc 329  Q
    ||||||| |||  || |||||||||||||||||||||||||| |||| || ||||||||||||||||||||||| |||||||||||||||||||| |  |    
40518569 ggggagtattgtgtt-caagtgtgagttatatgtcccacatcagatagaaaagtaaaggttgaacaccttataaataagaggacccataaacccaatgac 40518667  T
330 ttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcc 400  Q
    |||||||||||||||||||||||  ||| |||||||||||| ||||||||||||||| |||||||||||||    
40518668 ttaaggttttgggtaagagtgtgacgtcactcttgcttgtgtggttgttctagcctcaatgtggacggtcc 40518738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 149; E-Value: 3e-78
Query Start/End: Original strand, 235 - 403
Target Start/End: Original strand, 3669678 - 3669846
Alignment:
235 gtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaag 334  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||    
3669678 gtgttggtttgcaagtgtgagttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagaggactcataaactcattgccttaag 3669777  T
335 gttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
3669778 gttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggatggtccccc 3669846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 142; E-Value: 4e-74
Query Start/End: Original strand, 177 - 398
Target Start/End: Original strand, 30359539 - 30359763
Alignment:
177 taagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcgg 273  Q
    ||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||| ||||| | ||  ||||||||||||||||||| |||||| |    
30359539 taagagcttccgcttgaagggggagcatgataaattgatggactcacacttgagggggaatgttgttgtgtacaagtgtgagttatatgtctcacatcag 30359638  T
274 ataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcgg 373  Q
    |||||| |||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||| ||| |||||    
30359639 ataaaagagtaaaagttgaacaccttataagtaagaggactcataaacccataaccttaagattttgggtaagagtgtggtgtctctcttacttatgcgg 30359738  T
374 ttgttctagcctcgatgtggacggt 398  Q
    |||||||| | ||||||||||||||    
30359739 ttgttctaacttcgatgtggacggt 30359763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 139; E-Value: 3e-72
Query Start/End: Original strand, 145 - 398
Target Start/End: Complemental strand, 9482857 - 9482608
Alignment:
145 tggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaattgatggactcacacttgagggggagtgttggttt 244  Q
    |||||||||||||||||| || ||| |||| |||||||||||||||||| |||| ||||  ||||||| |||||||||  |||||||||||||||| | |    
9482857 tggagaaaccagcaacggcgatacaagcaa-gtaagagcttccgcttgaagggg-gcacagtgaattgttggactcac--ttgagggggagtgttgttgt 9482762  T
245 gcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggta 344  Q
    | |   ||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||  ||    
9482761 gtacaagtgagttatatgttccacatgggataaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgcctaaagattttgtata 9482662  T
345 agagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggt 398  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||    
9482661 agagtgtggtatctctcttgcttgtgcggttgttctagcctcgatgtggacggt 9482608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 138; E-Value: 1e-71
Query Start/End: Original strand, 128 - 402
Target Start/End: Complemental strand, 8919039 - 8918764
Alignment:
128 cagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaattgatggactcacacttg 227  Q
    ||||||||||||||||| | ||||| ||||||||| || ||| |||| || ||||||||||||| | ||||  || ||||||| ||||||||||||||||    
8919039 cagtgtcggtccgtttgcgaagaaatcagcaacggcgatacaagcaa-gttagagcttccgcttaaagggggacatgatgaatagatggactcacacttg 8918941  T
228 agggggagtgttg--gtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccat 325  Q
    |||||||||||||  || ||||||||||||||| |||||||||||| ||||  | |||||||||||||||| ||||||||||||||||||||||||| ||    
8918940 agggggagtgttgttgtgtgcaagtgtgagttacatgtcccacatcagatagcagagtaaaggttgaacactttataagtaagaggacccataaacctat 8918841  T
326 taccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |  ||||||||||||||||||||||||  |||| |||||| |||| ||||||| || ||||||||||||||||||||    
8918840 tgacttaaggttttgggtaagagtgtgacgtctttcttgcgtgtgtggttgttttaacctcgatgtggacggtcccc 8918764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 137; E-Value: 4e-71
Query Start/End: Original strand, 234 - 395
Target Start/End: Original strand, 30441071 - 30441236
Alignment:
234 agtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacacctta----taagtaagaggacccataaacccattacc 329  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    ||||||||||| |||||||||||||| ||    
30441071 agtgttggtttgcaagtgtgagttatatgtcccacatcggctaaaatagtaaaggttgaacaccttaattataagtaagagggcccataaacccattgcc 30441170  T
330 ttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 395  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30441171 ttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 30441236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 137; E-Value: 4e-71
Query Start/End: Original strand, 195 - 403
Target Start/End: Original strand, 34835160 - 34835368
Alignment:
195 ggggagcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcggataaaatagtaaaggttga 292  Q
    |||| ||| |||||||||||||||||||  |||||||||||||||| | ||  |||| ||||||||||||||||||||| ||||||||||||||||||||    
34835160 ggggggcatgatgaattgatggactcac--ttgagggggagtgttgctgtgtacaagggtgagttatatgtcccacatccgataaaatagtaaaggttga 34835257  T
293 acaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    ||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||     
34835258 acaccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgta 34835357  T
393 gacggtccccc 403  Q
    |||||||||||    
34835358 gacggtccccc 34835368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 137; E-Value: 4e-71
Query Start/End: Original strand, 147 - 403
Target Start/End: Original strand, 45122907 - 45123165
Alignment:
147 gagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttg--gtt 243  Q
    |||||||||||||||  || ||| |||| |||||||||||||||||| |||||| || ||||||| |||||||| ||||||||||||||||||||  ||     
45122907 gagaaaccagcaacgacgatacaagcaa-gtaagagcttccgcttgaagggggaacatgatgaatagatggacttacacttgagggggagtgttgctgtg 45123005  T
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||  ||||||||| |||||||||||| |||  |||||||||||||||    
45123006 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttaaacacct--taagtaagatgacccataaacctattttcttaaggttttgggt 45123103  T
344 a--agagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |  |||||||||||||||||||  ||||| ||||||||||  ||||||||||||||||||||    
45123104 aagagagtgtggtgtctctcttatttgtggggttgttctaatctcgatgtggacggtccccc 45123165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 133; E-Value: 1e-68
Query Start/End: Original strand, 246 - 410
Target Start/End: Complemental strand, 3038446 - 3038282
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||    
3038446 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacactttataagtaaaaggacccataaacccattgccttaaggttttgggtaa 3038347  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    ||||||||  ||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||    
3038346 gagtgtggcatctctcttgcttgtgtggttgttctagcctcgatgtggacggtcctccgagctcc 3038282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 133; E-Value: 1e-68
Query Start/End: Original strand, 199 - 403
Target Start/End: Original strand, 34835427 - 34835634
Alignment:
199 agcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcg-gataaaatagtaaaggttgaaca 295  Q
    |||| ||||||||||||||||||||||||||||||||||||| | ||  |||| |||||||||||||||||| ||  |||||||||||||||||| ||||    
34835427 agcatgatgaattgatggactcacacttgagggggagtgttgctgtgtacaagggtgagttatatgtcccacgtcccgataaaatagtaaaggtttaaca 34835526  T
296 ccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 395  Q
    |||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||| |||    
34835527 ccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgtagac 34835626  T
396 ggtccccc 403  Q
    ||||||||    
34835627 ggtccccc 34835634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 133; E-Value: 1e-68
Query Start/End: Original strand, 199 - 403
Target Start/End: Original strand, 34835693 - 34835900
Alignment:
199 agcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcg-gataaaatagtaaaggttgaaca 295  Q
    |||| ||||||||||||||||||||||||||||||||||||| | ||  |||| |||||||||||||||||| ||  |||||||||||||||||| ||||    
34835693 agcatgatgaattgatggactcacacttgagggggagtgttgctgtgtacaagggtgagttatatgtcccacgtcccgataaaatagtaaaggtttaaca 34835792  T
296 ccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 395  Q
    |||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||| |||    
34835793 ccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgtagac 34835892  T
396 ggtccccc 403  Q
    ||||||||    
34835893 ggtccccc 34835900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 194 - 410
Target Start/End: Original strand, 9309303 - 9309520
Alignment:
194 gggggagcacgatgaattgatggactcacacttgagggggagtgttg--gtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttg 291  Q
    ||||||||||||| || ||||||||||||| ||||||||||||||||  || |||||||||||||||||||||||||||||||||||| |||||| ||||    
9309303 gggggagcacgataaagtgatggactcacaattgagggggagtgttgttgtgtgcaagtgtgagttatatgtcccacatcggataaaagagtaaatgttg 9309402  T
292 aacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgt 391  Q
    |||||||||||||||||||||||| ||||| |||| ||||||||| | |||||||||||||||||||||| |   | || ||||||||||||||||||||    
9309403 aacaccttataagtaagaggacccttaaactcattgccttaaggtgtcgggtaagagtgtggtgtctctc-tcagtatgtggttgttctagcctcgatgt 9309501  T
392 ggacggtcccccgcgctcc 410  Q
    ||||||||||||| |||||    
9309502 ggacggtcccccgagctcc 9309520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 124 - 403
Target Start/End: Original strand, 45122515 - 45122783
Alignment:
124 caagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcac 222  Q
    ||||||||||||||||||||| |||| ||||| ||||   || |||     |||||||||||||||| || ||||||||| ||||||| || | ||||||    
45122515 caagcagtgtcggtccgtttgcggaggaaccaacaacatcgataca-----agtaagagcttccgctggaagggggagcatgatgaatagaagaactcac 45122609  T
223 acttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacc 322  Q
    |||||||||||||||||| | ||||||||      ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||     
45122610 acttgagggggagtgttg-tgtgcaagtg------atatggcccgcatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaact 45122702  T
323 cattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    ||||  |||||||||||||||| |||||||| |||||||||||||||| |||||||| |||||||||||||| ||||||||    
45122703 cattgtcttaaggttttgggtatgagtgtggcgtctctcttgcttgtgtggttgttcaagcctcgatgtggaaggtccccc 45122783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 128; E-Value: 9e-66
Query Start/End: Original strand, 236 - 403
Target Start/End: Complemental strand, 1014411 - 1014244
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaagg 335  Q
    |||||||||||||||||||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||| |    
1014411 tgttggtttgcaagtgtgagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccgtaaactcgttaccttaaag 1014312  T
336 ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||    
1014311 ttttgggtaagagtgtggtgtctctcctgcttgtgcggttgttctagcctcgatgtggatggttcccc 1014244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 123; E-Value: 9e-63
Query Start/End: Original strand, 196 - 394
Target Start/End: Original strand, 6731856 - 6732045
Alignment:
196 gggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaaca 295  Q
    ||||||| ||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||       
6731856 gggagcatgatgaatagatggactcacatttgagggggagtgttgttttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttga--- 6731952  T
296 ccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
          ||||||||| |||||||||  |||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||    
6731953 ------aagtaagagaacccataaattcattgccttaaggttttgagtaagagtgtggtgtctctcttgcttatgcggttgttctaacctcgatgtgga 6732045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 124 - 392
Target Start/End: Original strand, 147712 - 147968
Alignment:
124 caagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcac 222  Q
    ||||||||||||||||||||| |||||||||| |||||  || |||     ||||||||||||||||| | ||||||||  |||||||||||||||||||    
147712 caagcagtgtcggtccgtttgcggagaaaccaacaacgacgataca-----agtaagagcttccgcttaaagggggagct-gatgaattgatggactcac 147805  T
223 acttgagggggagtgttg--gtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaa 320  Q
    ||||||||||||||||||  || |||||||||||||||||||||||||||| ||||||| |||||| |||||||| | ||||         |||||||||    
147806 acttgagggggagtgttgttgtgtgcaagtgtgagttatatgtcccacatctgataaaaaagtaaatgttgaacaacatata---------acccataaa 147896  T
321 cccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    || ||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||    
147897 cctattgccttaaggttttgggtaagagtgtggtgtctctcttacttgtgcagttgttctagcctcaatgtg 147968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 246 - 394
Target Start/End: Original strand, 34834878 - 34835026
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||| ||||||| |||| ||||||||||||||||||    
34834878 caagtgtgagttatatgtcccacattggataaaatagtaaaggttaaacaccttataagtaagatgactcataaactcattgccttaaggttttgggtaa 34834977  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||    
34834978 gagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtgga 34835026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 246 - 402
Target Start/End: Complemental strand, 37544646 - 37544490
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| ||||||||||||||||    
37544646 caagtgtgagttataagtcgcacatcggataaaatagtaaaggttgaacacattataagaaagaggacccataaatccattactttaaggttttgggtaa 37544547  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||    
37544546 gagtgtggtgtctttcttacttgtgcggttgttctagcctcgatgtggacgatcccc 37544490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 244 - 392
Target Start/End: Complemental strand, 45122215 - 45122067
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||  |||||||||||||||    
45122215 tgcaagtgtgagttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagagaacccataaactcattttcttaaggttttgggt 45122116  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||||    
45122115 aagagtgtggtgtctctcttacttgtggggttgttctagcctcgatgtg 45122067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 244 - 402
Target Start/End: Original strand, 9608745 - 9608903
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
9608745 tgcaagtgtgagttatatgtcccatatcggatagaaaagtaaaggttgaacaccttataagtaagatgacccataaacccatcaccttaaggttttgggt 9608844  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    | |||||||| |||||||||||| ||| |||||||||||||||||||||||||| ||||    
9608845 atgagtgtggcgtctctcttgctagtgaggttgttctagcctcgatgtggacggccccc 9608903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 134 - 403
Target Start/End: Complemental strand, 18371925 - 18371660
Alignment:
134 cggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggg 232  Q
    |||| |||||| ||||||||||||| ||| || |||  ||||  |||||||||||||||| ||||| ||||||| || ||||||||||||||||||||||    
18371925 cggttcgtttgcggagaaaccagcagcggcgatacaaacaaataaagagcttccgcttgaagggggggcacgataaagtgatggactcacacttgagggg 18371826  T
233 gagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattacctta 332  Q
    ||||| || | || |   |||||||||||||| ||||||||||||||||||||||||||||||     ||||||||| |||||||||||||| | |||||    
18371825 gagtgctgttgtgtagaagtgagttatatgtcacacatcggataaaatagtaaaggttgaaca----ttaagtaagaagacccataaaccca-tgcctta 18371731  T
333 aggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||||||||||||| |||||   ||||||||||| |||||| |||||||||||||| ||||    
18371730 aggttttgggtaagagtgtggtgtgtctctcatttgtgcggttgctctagcttcgatgtggacggttcccc 18371660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 246 - 403
Target Start/End: Complemental strand, 1514071 - 1513914
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
1514071 caagtatgagttatatatcccacatcggataaaagagtaaaggttgaacaccttataagtaagaggacccttaaacccataaccttaaggttttgggtaa 1513972  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
     |||||||| |||||||| | |||| |||| |||||||||||||||||||||||||||    
1513971 aagtgtggtatctctcttacatgtggggttattctagcctcgatgtggacggtccccc 1513914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 113; E-Value: 8e-57
Query Start/End: Original strand, 247 - 403
Target Start/End: Original strand, 147454 - 147610
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaag 346  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||| |||||| ||||||||||||    
147454 aagtgtgagttatatgtcccacatcggataaaagagtaaaggttgaacaccttataaataagaggacccataaacctattgccttaaagttttgggtaag 147553  T
347 agtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    ||||||| |||||||||||||||||||| |||||||| | |||||||  ||||||||    
147554 agtgtggcgtctctcttgcttgtgcggtagttctagcattgatgtgggtggtccccc 147610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 113; E-Value: 8e-57
Query Start/End: Original strand, 236 - 425
Target Start/End: Complemental strand, 20870741 - 20870550
Alignment:
236 tgttggtttgcaagtgtgagttatat--gtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaa 333  Q
    ||||||||||||||||||||||||||  || ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||    
20870741 tgttggtttgcaagtgtgagttatatatgttccacatcagataaaatagtaaaggttgaacatcttataagtaagaggacccataaacccactgccttaa 20870642  T
334 ggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataaccaaaca 425  Q
    | |||||| |||||||||||||||||||||||||||| |||||||||| ||| ||| |||||||||| ||  ||||| ||||| ||| ||||    
20870641 gattttggataagagtgtggtgtctctcttgcttgtgtggttgttctaaccttgatatggacggtcctcctggctcccctcatgacccaaca 20870550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 244 - 410
Target Start/End: Complemental strand, 6877021 - 6876854
Alignment:
244 tgcaagtgtgagttatat-gtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttggg 342  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||| || ||||  |||| |||||||||    
6877021 tgcaagtgtgagttatatagtcccacatcggataaaaaagtaaaggttgaacaccttataaataagatgacccatacactcattgtcttagggttttggg 6876922  T
343 taagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    |||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |||||    
6876921 taagagtgtggtgtttctcttgtttgtgtggttgttctagcctcgatgtggacggtcccccgagctcc 6876854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 246 - 410
Target Start/End: Original strand, 40518071 - 40518237
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaata--gtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||||||| |||||| |||||||| |  ||||||||||||||||||||||||||  ||||||||||||||| | ||||||||||||||||    
40518071 caagtgtgagttatatgttccacattggataaaaaaaagtaaaggttgaacaccttataagtaaatggacccataaacccaatgccttaaggttttgggt 40518170  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    |||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||| |||||    
40518171 aagagtgtggcgtctctcttgcttgtgtggttgttctagccttgatgtggacggtcccccgagctcc 40518237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 269 - 398
Target Start/End: Complemental strand, 9483320 - 9483191
Alignment:
269 atcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttg 368  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||| |    
9483320 atcggataaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgtcttaaggttttgggtaagagtgtggtgtctcttttgctcg 9483221  T
369 tgcggttgttctagcctcgatgtggacggt 398  Q
    ||||||||||||||||||||||||||||||    
9483220 tgcggttgttctagcctcgatgtggacggt 9483191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 181 - 395
Target Start/End: Complemental strand, 45121878 - 45121663
Alignment:
181 agcttccgcttgagggggagcacgatgaattgatggactcacacttgagggggagtgttggtttg--caagtgtgagttatatgtcccacatcggataaa 278  Q
    ||||||||||   ||||||||||||| || |||||||||||||||| ||||||||||||| | ||  |||||||||||| | ||||||||||||||||||    
45121878 agcttccgctctggggggagcacgataaagtgatggactcacacttaagggggagtgttgttgtgtacaagtgtgagttgt-tgtcccacatcggataaa 45121780  T
279 atagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgtt 378  Q
    | |||||||||||| ||||||||||||||||||| ||||||||| |   ||||||||||||| ||||||||||| | |||||||| ||| || |||||||    
45121779 agagtaaaggttgatcaccttataagtaagaggatccataaacctacagccttaaggttttgagtaagagtgtgatatctctcttacttatggggttgtt 45121680  T
379 ctagcctcgatgtggac 395  Q
    |||||||||||||||||    
45121679 ctagcctcgatgtggac 45121663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 246 - 401
Target Start/End: Complemental strand, 33113523 - 33113368
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||  ||||||||||||||||||||||||| |||| ||||||| ||||||||||    
33113523 caagtttgagttatatgtcctacatcggataaaatagtaaaggttgaacgtcttataagtaagaggacccataaactcattgccttaagattttgggtaa 33113424  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccc 401  Q
    ||||||||||||||||||||| ||| ||||||||||| ||| ||| ||||||||||    
33113423 gagtgtggtgtctctcttgctagtgtggttgttctaggctcaatgcggacggtccc 33113368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 246 - 402
Target Start/End: Complemental strand, 25561972 - 25561815
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggtttt-gggta 344  Q
    |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||  ||||||||||| |||||    
25561972 caagtgtgagttatatgtcccacatcggataaaagagtaaacgttgaacaccttataagtaagaggacccataaactcattgtcttaaggttttggggta 25561873  T
345 agagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    ||||||||   ||||||||||||||| ||||| ||||||||||||||||| |||||||    
25561872 agagtgtgacatctctcttgcttgtgtggttgctctagcctcgatgtggaaggtcccc 25561815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 105; E-Value: 5e-52
Query Start/End: Original strand, 246 - 394
Target Start/End: Original strand, 30359273 - 30359421
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||  ||||||||||||||||||    
30359273 caagtgtgagttatatgtctcacatcggataaaagagtaaatgttgaacaccttataagcaagaggacccataaacccatagccttaaggttttgggtaa 30359372  T
346 gagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 394  Q
    |||||||||||||||||| ||||||  |||||| ||||||| |||||||    
30359373 gagtgtggtgtctctctttcttgtgatgttgttttagcctcaatgtgga 30359421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 244 - 403
Target Start/End: Complemental strand, 45122068 - 45121909
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||| |||| ||||||| ||||||||    
45122068 tgcaagtgtgagttatatgtcccacatcgcataaaatagtaaaggttgaacactttataagtaagaggactcataaactcattgccttaagattttgggt 45121969  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    || ||||||| |||||| ||||| ||| |||| ||| |||||||||||||| ||||||||    
45121968 aacagtgtggcgtctcttttgctcgtgtggttattcaagcctcgatgtggaaggtccccc 45121909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 238 - 396
Target Start/End: Complemental strand, 40579670 - 40579512
Alignment:
238 ttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggtt 337  Q
    ||||||| ||||||||| ||||||||  || || ||||||||||||||||||||||||||||||||||||||||||||||||||  ||| | ||||||||    
40579670 ttggtttccaagtgtgaattatatgtttcatattggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacttattgctttaaggtt 40579571  T
338 ttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacg 396  Q
    || |||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||    
40579570 ttaggtaagagtgtggtgtctctattgcttgtacggttgttctatcctcgatgtggacg 40579512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 244 - 402
Target Start/End: Original strand, 5915872 - 5916025
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||||||||||| |||| ||||||||  ||||| ||| ||||| |||    ||||||||||||||||| |||| ||||||||||||||||    
5915872 tgcaagtgtgagttatatgtcctacattggataaaaatgtaaa-gtttaacacttta----taagaggacccataaactcattgccttaaggttttgggt 5915966  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 402  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5915967 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccc 5916025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 254 - 425
Target Start/End: Complemental strand, 18372142 - 18371970
Alignment:
254 agttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtgg 353  Q
    |||||||||| |||||||  ||||||||||||||||||||||||||||||||||||||| |||||||| |||| | ||||||||||||||||||||||||    
18372142 agttatatgtaccacatccaataaaatagtaaaggttgaacaccttataagtaagaggatccataaactcattgctttaaggttttgggtaagagtgtgg 18372043  T
354 tgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg-tcccccgcgctcctctcataaccaaaca 425  Q
    ||| ||||| ||||||||||||| ||||||||| ||||| |||| ||||||| ||||| ||||| ||| ||||    
18372042 tgtttctctcgcttgtgcggttgctctagcctcaatgtgaacggttcccccgagctcccctcatgacccaaca 18371970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 178 - 316
Target Start/End: Complemental strand, 18372481 - 18372342
Alignment:
178 aagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggata 276  Q
    |||||||||| ||||| ||||||||||||| || |||||||||||||||||||||||||||||| | || |||||||||||||||||| |||||||||||    
18372481 aagagcttccccttgaagggggagcacgataaagtgatggactcacacttgagggggagtgttgttgtgaaagtgtgagttatatgtctcacatcggata 18372382  T
277 aaatagtaaaggttgaacaccttataagtaagaggaccca 316  Q
    ||||||||||||||||||||||||||||||||| ||||||    
18372381 aaatagtaaaggttgaacaccttataagtaagaagaccca 18372342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 251 - 404
Target Start/End: Complemental strand, 70425 - 70272
Alignment:
251 gtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtg 350  Q
    ||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||| | |||||||||||| ||||||||||    
70425 gtgagttatatgtcccacatcggataaaagagtaaatgttgaacatcttataagtaagaggacccataaacccactgccttaaggttttaggtaagagtg 70326  T
351 tggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccg 404  Q
    ||  |||| ||||||||||| |||||||||| |||| ||| |||||||| ||||    
70325 tgacgtctatcttgcttgtgtggttgttctaacctcaatgcggacggtctcccg 70272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 215 - 403
Target Start/End: Original strand, 6651476 - 6651653
Alignment:
215 ggactcacacttgagggggagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacc 314  Q
    ||||||||||||||||||  |||||| ||||||||||  ||||||||||| |||||||||||||||||||||||||||| |         |||||| |||    
6651476 ggactcacacttgaggggaggtgttgttttgcaagtg--agttatatgtctcacatcggataaaatagtaaaggttgaaaa---------taagagaacc 6651564  T
315 cataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    ||||||  |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||    
6651565 cataaattcattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcgattgttctaacctcgatgtggatggtccccc 6651653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 248 - 401
Target Start/End: Complemental strand, 18380171 - 18380020
Alignment:
248 agtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaaga 347  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| || || ||||||||| ||||||||||||||| ||||||    
18380171 agtgtgagttatatatcccacatcgaataaaatagtaaaggttgaacaccttataagtaagggggcctataaacccactaccttaaggttttgagtaaga 18380072  T
348 gtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccc 401  Q
    ||||||||   |||||||||||||| || ||||||| ||||||||||| |||||    
18380071 gtgtggtg--cctcttgcttgtgcgattcttctagcttcgatgtggacagtccc 18380020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 238 - 425
Target Start/End: Original strand, 32305478 - 32305658
Alignment:
238 ttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggtt 337  Q
    |||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||    
32305478 ttggtttgcaagtgtgagttatatgtc-------ggataaaatagtaaaggttgaacaccttataagtaagaagacctataaacccattaccttaagatt 32305570  T
338 ttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcataaccaaaca 425  Q
    |||| ||||||||||| |||| | || ||| ||| ||||||||| ||| |||||||||||||||||   |||| ||| ||||||||||    
32305571 ttggataagagtgtggcgtctttattacttatgcagttgttctaaccttgatgtggacggtccccctgactcccctcgtaaccaaaca 32305658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 244 - 404
Target Start/End: Original strand, 41972158 - 41972321
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggtt---ttg 340  Q
    ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| | |||||||||||||||||| || ||| |||   |||    
41972158 tgcaagtgtgagttatatgtcccacatcggatagaaaagtaaaggttgaacaccttataagtgataggacccataaacccattgccataaagttttgttg 41972257  T
341 ggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccg 404  Q
    ||||||||||||| ||| |||||||||||| |||||||| |||||| || ||||||||| ||||    
41972258 ggtaagagtgtggcgtcactcttgcttgtgtggttgttccagcctcaatatggacggtctcccg 41972321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 244 - 400
Target Start/End: Original strand, 5420651 - 5420807
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||  ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||  ||    
5420651 tgcaagtgtgtattatatgtcccacatcggatagaatagtaaaggttgaacatcttataagtaagaggactcataaacccattgccttaaggttttttgt 5420750  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcc 400  Q
    |||||||||  ||||| ||  |||||| |||||||| ||||||||||||||| ||||    
5420751 aagagtgtgacgtctccctcacttgtgtggttgttcaagcctcgatgtggaccgtcc 5420807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 136 - 316
Target Start/End: Complemental strand, 18372966 - 18372785
Alignment:
136 gtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttg--agggggagcacgatgaattgatggactcacacttgaggggg 233  Q
    ||||||||| ||||||||||||| ||| || |||  ||||  |||||||||| | |   |||||||||||||| || |||||||||||||||||||| |     
18372966 gtccgtttgcggagaaaccagcagcggcgatacaaacaaataaagagcttcccccttcaagggggagcacgataaagtgatggactcacacttgaggag- 18372868  T
234 agtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggaccca 316  Q
    ||||||| | || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
18372867 agtgttgttgtgaaagtgtgagttatatgtcacacatcggataaaatagtaaaggttgaacaccttataagtaagaggaccca 18372785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 244 - 410
Target Start/End: Original strand, 9308977 - 9309147
Alignment:
244 tgcaagtgtgagttatatgtcc--cacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgg 341  Q
    ||||||||||||||||||||||  |||||| ||||||| |||||| ||||||||  ||||||||||||||||||||||||||||| ||| ||||||||||    
9308977 tgcaagtgtgagttatatgtcctacacatcagataaaagagtaaaagttgaacatgttataagtaagaggacccataaacccattgcctaaaggttttgg 9309076  T
342 gtaag---agtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    | |||   ||||||||||||||||  | | || ||||||||||||||||||||||||||||||||| |||||    
9309077 gcaagagtagtgtggtgtctctctcac-tatgtggttgttctagcctcgatgtggacggtcccccgagctcc 9309147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 178 - 348
Target Start/End: Complemental strand, 18373157 - 18372988
Alignment:
178 aagagcttccgcttga-gggggagcacgatgaattgatggactcacacttgagggggagtgttggtttgca-agtgtgagttatatgtcccacatcggat 275  Q
    |||||||||| ||||| ||||||||||||| || |||||||||||||||||||  ||||||||| | || | ||||||| ||||||||||||| ||||||    
18373157 aagagcttccccttgatgggggagcacgataaagtgatggactcacacttgagatggagtgttgttgtgtacagtgtgatttatatgtcccacttcggat 18373058  T
276 aaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagag 348  Q
    |||||||||||||||||||||||||||| ||||||||| ||||||| |||| ||   ||||||||||||||||    
18373057 aaaatagtaaaggttgaacaccttataaataagaggactcataaactcattgcc---aggttttgggtaagag 18372988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 134 - 288
Target Start/End: Complemental strand, 18372640 - 18372485
Alignment:
134 cggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgaggggga-gcacgatgaattgatggactcacacttgagggg 232  Q
    ||||||||||| ||||||||||||| ||| ||  ||  ||||  |||||||||| ||||| ||||| ||||||| || ||||||||||||||||||||||    
18372640 cggtccgtttgcggagaaaccagcagcggcgattcaaacaaataaagagcttccccttgaaggggaagcacgataaagtgatggactcacacttgagggg 18372541  T
233 gagtgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaagg 288  Q
    |||||||| | || ||||||||||||||||||||||||||||||||||||||||||    
18372540 gagtgttgttgtgaaagtgtgagttatatgtcccacatcggataaaatagtaaagg 18372485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 247 - 425
Target Start/End: Complemental strand, 32640682 - 32640508
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaag 346  Q
    ||||||||||||| |||| |||||||||||||| |||||||||||||||     || ||||||||||| ||||||||||| |||||||||||||||||||    
32640682 aagtgtgagttatctgtctcacatcggataaaagagtaaaggttgaaca-----taggtaagaggaccgataaacccattgccttaaggttttgggtaag 32640588  T
347 agtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcc-cccgcgctcctctcataaccaaaca 425  Q
    ||||| | ||||||||||||| || | |||||||||||||||||||  |||||| || | ||||| ||||| ||||||||    
32640587 agtgttgcgtctctcttgcttttgtgattgttctagcctcgatgtgagcggtccgccagagctcccctcatgaccaaaca 32640508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 244 - 395
Target Start/End: Original strand, 9507777 - 9507933
Alignment:
244 tgcaagtgtgagttatatgtcc--cacatcggataaaat---agtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttt 338  Q
    |||||||||||||||||| |||  || || ||||||||    ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||    
9507777 tgcaagtgtgagttatatctcctccatattggataaaagtacagtaaaggttgaataccttataagtaagaggactcataaacccattaccttaaggttt 9507876  T
339 tgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggac 395  Q
    ||||||||||||||| |||||| |  ||| |  |||||||| |||||||||||||||    
9507877 tgggtaagagtgtggcgtctctatctcttatatggttgttcaagcctcgatgtggac 9507933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 236 - 332
Target Start/End: Complemental strand, 41416335 - 41416241
Alignment:
236 tgttggtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattacctta 332  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||    
41416335 tgttggtttgcaagtg--agttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggatccataaacctatcacctta 41416241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 246 - 362
Target Start/End: Original strand, 8794113 - 8794229
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||||||||||||| |||||||||||||| | |||| |||||||| ||||||||||||||||| |||||||| | || ||||||||||||||| |    
8794113 caagtgtgagttatatgtctcacatcggataaaagaataaatgttgaacatcttataagtaagaggactcataaacctaatatcttaaggttttgggtga 8794212  T
346 gagtgtggtgtctctct 362  Q
    ||||| |||||||||||    
8794213 gagtgcggtgtctctct 8794229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 319 - 410
Target Start/End: Complemental strand, 40579352 - 40579261
Alignment:
319 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||    
40579352 aacccattgccttaggattttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggactgtcccccgagctcc 40579261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 244 - 392
Target Start/End: Complemental strand, 4154824 - 4154678
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||||||||||||||||||| |||| || |||  ||||||||||| |||||||| | ||||||||||||| |||| ||  ||||||||||||    
4154824 tgcaagtgtgagttatatgtcccacatctgatagaaaagtggaggttgaacactttataagtgaaaggacccataaactcattgccccaaggttttgggt 4154725  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 392  Q
    |||||||||| |||||||  ||||||| ||||| ||| |||| ||||||    
4154724 aagagtgtggcgtctctc--gcttgtgtggttgctctggcctagatgtg 4154678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 129 - 232
Target Start/End: Complemental strand, 3038202 - 3038099
Alignment:
129 agtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaattgatggactcacacttga 228  Q
    |||||||||||||||| ||||||||||||||||| || |||    |||||||||||||||||||||||||||| |||||||||||||||||||||||| |    
3038202 agtgtcggtccgtttgaggagaaaccagcaacggcgatacaaagcaagtaagagcttccgcttgagggggagctcgatgaattgatggactcacacttta 3038103  T
229 gggg 232  Q
    ||||    
3038102 gggg 3038099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 267 - 381
Target Start/End: Original strand, 9609108 - 9609222
Alignment:
267 acatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctcttgct 366  Q
    ||||| |||| || ||||||||||||||| ||||||||||||| |||||||||||||||  |||||| ||||| ||||||||||||| ||||||||||||    
9609108 acatcagatagaaaagtaaaggttgaacatcttataagtaagatgacccataaacccatcgccttaatgttttcggtaagagtgtggcgtctctcttgct 9609207  T
367 tgtgcggttgttcta 381  Q
     ||| ||||||||||    
9609208 agtgtggttgttcta 9609222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 247 - 357
Target Start/End: Complemental strand, 43274934 - 43274824
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaag 346  Q
    |||||||||||||||||  |||||| ||||||| ||||||||||||| |  ||||||||||||||||||||||||| |||  |||||||||||| |||||    
43274934 aagtgtgagttatatgtttcacatcagataaaagagtaaaggttgaatatattataagtaagaggacccataaacctattgtcttaaggttttgagtaag 43274835  T
347 agtgtggtgtc 357  Q
    |||||||||||    
43274834 agtgtggtgtc 43274824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 178 - 362
Target Start/End: Complemental strand, 4154506 - 4154321
Alignment:
178 aagagcttccgcttgagggg-gagcacgatgaattgatggactcacacttgagggggag--tgttggtttgcaagtgtgagttatatgtcccacatcgga 274  Q
    ||||||||| |||||||||| ||||| || |  |||||||||||||||||||||||||   ||||| | ||||| |||||||||||||||| ||||| ||    
4154506 aagagcttctgcttgaggggtgagcatgaagttttgatggactcacacttgagggggaaattgttg-tgtgcaaatgtgagttatatgtcctacatcaga 4154408  T
275 taaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagagtgtggtgtctctct 362  Q
    || || |||  ||||||||||| |||||||| ||| ||||||||||| |||| ||||||  ||||||||||| ||||| |||||||||    
4154407 tagaaaagtggaggttgaacactttataagtgaga-gacccataaactcattgccttaatattttgggtaagtgtgtgatgtctctct 4154321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 1014219 - 1014122
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||||||||||||||||||||||| |||| ||| | ||||||  |||||||||||||| |||||| |||||||||||||||||||||||||||    
1014219 tggtatcagagccccggttcgacgaagggtacgactgaggcagccggtc-gttgcgcagaaagccgcaacggcggtacaagcagcaagtggctccttgt 1014122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 9309164 - 9309262
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||| |||| |||||||| ||||| |||||||| |||||||| ||||||| |||||||| ||||||||| |||||||||||||||||||||||    
9309164 tggtatcagaaccccagttcgacggagggtacgaccgaggccgccggtcagttgcgtagaaagcaacaacgacggcacaagcagcaagtggctccttgt 9309262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 246 - 352
Target Start/End: Complemental strand, 18372758 - 18372656
Alignment:
246 caagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaa 345  Q
    ||||||||| |||||||| |||  |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||   |||||||||||||    
18372758 caagtgtgatttatatgttccatttcggataaaatagtaaaggttgaaca-cttataagtaagaggactcataaacccattgcc---aggttttgggtaa 18372663  T
346 gagtgtg 352  Q
    |||||||    
18372662 gagtgtg 18372656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 328 - 403
Target Start/End: Complemental strand, 8919218 - 8919143
Alignment:
328 ccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 403  Q
    |||||||||||||| |||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||    
8919218 ccttaaggttttggataagagtgtggtgtctcttttgcttgtgtggttgttctagcttcgatgtggacggtccccc 8919143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 244 - 410
Target Start/End: Complemental strand, 9620834 - 9620670
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||||||||||||||| |||| | |||| || |||| | ||||| ||| |||||||| ||||||||||||||| |||| ||||||| ||||   |    
9620834 tgcaagtgtgagttatatgtctcacaacagatagaaaagtagaagttgatcactttataagtgagaggacccataaactcattgccttaagatttt--at 9620737  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    |||||| || |||||||||  |||||| ||||| ||  |||| |||||||||||||||||| |||||    
9620736 aagagtttgatgtctctctcacttgtgtggttgctcaggcctggatgtggacggtcccccgggctcc 9620670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 248 - 393
Target Start/End: Complemental strand, 43398225 - 43398077
Alignment:
248 agtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaa---gaggacccataaacccattaccttaaggttttgggta 344  Q
    |||||||||||||| || || |||||||| || ||||||||||||||||||||||| |||   |||||||||||||  |||| |||||| ||||||| ||    
43398225 agtgtgagttatatatctcatatcggatagaaaagtaaaggttgaacaccttataaataagaggaggacccataaattcattgccttaaagttttggata 43398126  T
345 agagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgg 393  Q
    ||| ||||| || ||| || || ||||||||| |||| |||||||||||    
43398125 agaatgtggcgtttcttttactagtgcggttgctctaacctcgatgtgg 43398077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 244 - 393
Target Start/End: Original strand, 12283873 - 12284021
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||||| ||||||||||||||| || ||||||| |||||| |||||| | |||| |||||| | ||| ||||||| ||   | |||||||||||| |    
12283873 tgcaagtgtaagttatatgtcccacgtcagataaaaaagtaaatgttgaatatcttaaaagtaaaatgacacataaactcaagtc-ttaaggttttggat 12283971  T
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgg 393  Q
    |||||||| ||||||||||  |||||| ||||||||||||||| ||||||    
12283972 aagagtgtagtgtctctctcacttgtgtggttgttctagcctctatgtgg 12284021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 249 - 349
Target Start/End: Original strand, 20130454 - 20130553
Alignment:
249 gtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggtaagag 348  Q
    ||||||| |||||||| |||||||||||||| |||||| |||||||||||| ||||||||| || |||||||||||| |||||| |||||| ||||||||    
20130454 gtgtgagatatatgtctcacatcggataaaagagtaaaagttgaacacctt-taagtaagatgatccataaacccataaccttacggttttaggtaagag 20130552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 254 - 317
Target Start/End: Complemental strand, 25561792 - 25561729
Alignment:
254 agttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccat 317  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||    
25561792 agttatatgtcccacatcggataaaagagtaaaggttgaacaccttataagtaagagtacccat 25561729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 329 - 416
Target Start/End: Original strand, 41129073 - 41129160
Alignment:
329 cttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctcat 416  Q
    |||||||||||||||| |||||||||||||||||| |||||| |||||||| | |||||||||||||||||||||  ||||| |||||    
41129073 cttaaggttttgggtatgagtgtggtgtctctcttacttgtgtggttgttcaaacctcgatgtggacggtcccccaggctcccctcat 41129160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 247 - 326
Target Start/End: Complemental strand, 3037865 - 3037784
Alignment:
247 aagtgtgagttatat--gtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccatt 326  Q
    |||||||||||||||  || ||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||    
3037865 aagtgtgagttatatatgttccacatcggatgaaatagtaaatgttgaacaccttataagtaagaggactcataaacccatt 3037784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 338 - 410
Target Start/End: Complemental strand, 43274699 - 43274627
Alignment:
338 ttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    ||||||| |||||||||||||||||| ||| || |||||||| |||||||||||||||||||||||| |||||    
43274699 ttgggtatgagtgtggtgtctctcttacttatggggttgttccagcctcgatgtggacggtcccccgagctcc 43274627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 3669870 - 3669967
Alignment:
10 tggtatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagttgcgcagaaagcagcaacgacggtacaagcagcaagtggctccttgt 108  Q
    |||||||||||||||  ||| | ||||||| ||| |||| | ||||||  |||||||||||||| ||||| |||||||||||| |||||||||||||||    
3669870 tggtatcagagccccccttcaatgaagggtacgatcgaggcagccggtc-gttgcgcagaaagccgcaacaacggtacaagcaacaagtggctccttgt 3669967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 244 - 370
Target Start/End: Original strand, 5274775 - 5274901
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    ||||||| |||||||||||| | |||| | |||||| || | ||||||||||| |||||| |  || ||||||||||  |||| ||||||| ||||| ||    
5274775 tgcaagtatgagttatatgttctacattgaataaaaaaggagaggttgaacactttataaatgggaagacccataaaatcattgccttaagattttgagt 5274874  T
344 aagagtgtggtgtctctcttgcttgtg 370  Q
    ||||||||| ||||||| | |||||||    
5274875 aagagtgtgatgtctctatcgcttgtg 5274901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 344 - 416
Target Start/End: Complemental strand, 18372342 - 18372269
Alignment:
344 aagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacgg-tcccccgcgctcctctcat 416  Q
    ||||||||||||||||||| ||||||||||||| | ||| |||||||||||||| ||||||| ||||| |||||    
18372342 aagagtgtggtgtctctctcgcttgtgcggttgctttagtctcgatgtggacggttcccccgagctcccctcat 18372269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 355 - 410
Target Start/End: Complemental strand, 3038016 - 3037961
Alignment:
355 gtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcc 410  Q
    ||||||||  |||||| ||||||||||||||||||||||||||||||||| |||||    
3038016 gtctctctatcttgtgtggttgttctagcctcgatgtggacggtcccccgagctcc 3037961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 330 - 382
Target Start/End: Original strand, 16524451 - 16524503
Alignment:
330 ttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctag 382  Q
    ||||||||||| |||||||||||||||||||||| |||||| ||||| |||||    
16524451 ttaaggttttgagtaagagtgtggtgtctctcttacttgtgtggttgctctag 16524503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 18373292 - 18373236
Alignment:
280 tagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggt 336  Q
    |||||||||||||||||||||||| |||||||| |||| ||||||||  ||||||||    
18373292 tagtaaaggttgaacaccttataaataagaggatccattaacccattgtcttaaggt 18373236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 321 - 385
Target Start/End: Complemental strand, 20995497 - 20995433
Alignment:
321 cccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcct 385  Q
    |||||| |||||||||||||||||||| ||||||||||||||  |||||| ||||| ||| ||||    
20995497 cccattgccttaaggttttgggtaagaatgtggtgtctctctcacttgtgtggttgctctggcct 20995433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 247 - 343
Target Start/End: Original strand, 40991756 - 40991852
Alignment:
247 aagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaaggttttgggt 343  Q
    |||||||||||| | ||||||||| |  || || |||  ||||||||||| | |||||| |||||||||||||||||| | ||| ||||||||||||    
40991756 aagtgtgagttagaagtcccacattgcttagaaaagtggaggttgaacacttcataagtgagaggacccataaacccaatgcctcaaggttttgggt 40991852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 194 - 270
Target Start/End: Complemental strand, 43274777 - 43274699
Alignment:
194 gggggagcacgatgaattgatggactcacacttgagggggagtgttg--gtttgcaagtgtgagttatatgtcccacat 270  Q
    ||||||||||||| || |||||||||||||||||||||  |||||||  || | |||||||||||||||| || |||||    
43274777 gggggagcacgataaagtgatggactcacacttgagggacagtgttgttgtgtacaagtgtgagttatatatctcacat 43274699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 147637 - 147718
Alignment:
13 tatcagagccccggttcgacgaagggtgcgaccgagaccgccggttagtt-gcgcagaaagcagcaacgacggtacaagcag 93  Q
    |||||||||||||||||||| |||||| ||| |||| | ||| ||  ||| |||||||||||||||||  ||||||||||||    
147637 tatcagagccccggttcgacaaagggtacgatcgaggcagccagtccgtttgcgcagaaagcagcaacagcggtacaagcag 147718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 244 - 301
Target Start/End: Complemental strand, 20995559 - 20995502
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttat 301  Q
    ||||||||||||||||||||| |||||| ||||||| |||  ||||||||||| ||||    
20995559 tgcaagtgtgagttatatgtctcacatcagataaaaaagtggaggttgaacactttat 20995502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 244 - 321
Target Start/End: Original strand, 33831978 - 33832055
Alignment:
244 tgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaac 321  Q
    ||||||||||||||||||||| ||| | | | | || |||| | ||||||||| ||||||||||||||||| ||||||    
33831978 tgcaagtgtgagttatatgtctcacgttgaagagaaaagtagaagttgaacactttataagtaagaggacctataaac 33832055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 162
Target Start/End: Complemental strand, 9483084 - 9483047
Alignment:
125 aagcagtgtcggtccgtttgtggagaaaccagcaacgg 162  Q
    |||||||||||||||||||| |||||||||| ||||||    
9483084 aagcagtgtcggtccgtttgcggagaaaccatcaacgg 9483047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 315 - 352
Target Start/End: Complemental strand, 12156745 - 12156708
Alignment:
315 cataaacccattaccttaaggttttgggtaagagtgtg 352  Q
    ||||||||||||  ||||||||||||||||||||||||    
12156745 cataaacccattgtcttaaggttttgggtaagagtgtg 12156708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 79)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 112 - 370
Target Start/End: Original strand, 7553891 - 7554151
Alignment:
112 gcaacggcagtgcaagcagtgtcggtccgtttgtggagaaaccagcaacggagacacatgcaaagtaagagcttccgcttgagggggagcacgatgaatt 211  Q
    |||| ||| ||||||||||||| ||||||||||  |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
7553891 gcaatggcggtgcaagcagtgttggtccgtttgcagagaaaccagcaacggcgacacatgcaaagtaagagcttccgcttgagggggagcacgatgaatt 7553990  T
212 gatggactcacacttgagggggagtgttg--gtttgcaagtgtgagttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaaga