View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-11 (Length: 646)

Name: F9285J-LTR4-TNT-insertion-11
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-11
[»] chr3 (9 HSPs)
chr3 (7-634)||(10818239-10818866)
chr3 (7-469)||(1608189-1608649)
chr3 (15-469)||(1631687-1632137)
chr3 (15-401)||(1625204-1625579)
chr3 (471-634)||(1632180-1632349)
chr3 (471-634)||(1608692-1608861)
chr3 (471-634)||(1614168-1614337)
chr3 (510-634)||(1625737-1625862)
chr3 (381-469)||(1614032-1614125)
[»] chr7 (2 HSPs)
chr7 (15-461)||(18786145-18786594)
chr7 (510-589)||(18786688-18786767)

Alignment Details
Target: chr3 (Bit Score: 628; Significance: 0; HSPs: 9)
Name: chr3

Target: chr3; HSP #1
Raw Score: 628; E-Value: 0
Query Start/End: Original strand, 7 - 634
Target Start/End: Complemental strand, 10818866 - 10818239
7 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 106  Q
10818866 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 10818767  T
107 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 206  Q
10818766 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 10818667  T
207 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 306  Q
10818666 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 10818567  T
307 agagtttgtgttgcatatacaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatatgtgca 406  Q
10818566 agagtttgtgttgcatatacaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatatgtgca 10818467  T
407 tatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagtacaagaaagggttaattgaatatagaaataaaatcta 506  Q
10818466 tatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagtacaagaaagggttaattgaatatagaaataaaatcta 10818367  T
507 ttagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgtgattcacatagcaacat 606  Q
10818366 ttagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgtgattcacatagcaacat 10818267  T
607 tcataagcttacttataaatgcactaat 634  Q
10818266 tcataagcttacttataaatgcactaat 10818239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 7 - 469
Target Start/End: Original strand, 1608189 - 1608649
7 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 106  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
1608189 aattttcttgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgatt 1608288  T
107 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
1608289 gttcatttgtgttgtgtagtgtttgcatggctttggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggct 1608388  T
207 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 306  Q
    ||||||||||| || ||||||||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||    
1608389 attgagaaaattgatgataagaaaaagagcataaacaatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaa-ataata 1608487  T
307 agagtttgtgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaat-------taagcta 398  Q
    ||||||| |||||||||| ||||||||| |        ||| || |||||||||||||||||||||||||||||||||||||||||       ||| ||     
1608488 agagtttatgttgcatataacaaatgtgtg--------atatatgatgtttttgttcacttgtttttggttttgacttatgagaattaaaccctaaactc 1608579  T
399 tatgtgcatatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||| |  |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
1608580 tatatatatatatacataaatttttgtaggcggagtgtgaag-gtgaaaacgtgtggaatgaattgcaagt 1608649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 15 - 469
Target Start/End: Original strand, 1631687 - 1632137
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
1631687 tgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgattgttcattt 1631786  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||    
1631787 gtgttgtgtagtgtttgcatggctttggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggctgttgagaa 1631886  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaataagagtttg 314  Q
    ||| || ||||||||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||     
1631887 aattgatgataagaaaaagagcataaacaatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaa-ataataagagttta 1631985  T
315 tgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctata-----tgtgcata 408  Q
    |||||||||| ||||||||| |        ||| || |||||||||||||||||||||||||||||||||||||||||||| |  ||     | |  |||    
1631986 tgttgcatataacaaatgtgtg--------atatatgatgtttttgttcacttgtttttggttttgacttatgagaattaaaccctaaactctctatata 1632077  T
409 tatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||||| |||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||    
1632078 tatacataaatttttgtaggcggagtgtgaag-gtgtaaacgtgtggaatgaattgcaagt 1632137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 401
Target Start/End: Original strand, 1625204 - 1625579
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
1625204 tgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgattgttcattt 1625303  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| |||||    
1625304 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctattttgctcgaggaaggtccttttcttgatgaggctatggagaa 1625403  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaat-aagagttt 313  Q
    ||| ||||||| ||||| |||||  ||  ||||||||||||||||||||||||||||||||||||||||||||||||||      |||||| ||||||||    
1625404 aattgaagatacgaaaacgagcataaataatgtttttccaatgattgccataattcaattgtagaataattgaagagtt------tgaaataaagagttt 1625497  T
314 gtgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatat 401  Q
     |||||||||| ||||||||| |       |||| || ||| ||| ||| |||||||||||| ||||||||||||||||||| ||||||    
1625498 atgttgcatataacaaatgtgtg-------tataaatgatgctttagttgacttgtttttggatttgacttatgagaattaatctatat 1625579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1632180 - 1632349
471 caagaaagggttaattgaatatagaaataaaatct-----attagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||||     |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
1632180 caagaaagaattaattgaatataggaataaaatcttctctattagaaaaaatggtattacttaacaattcagaaagttgaagcctaattacttgtcattg 1632279  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||    
1632280 caagaaaaacaagtgtcctaatgtggattcacatagcaacattcttaagcttgcttataaatgcactaat 1632349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1608692 - 1608861
471 caagaaagggttaattgaatatagaaataaaat-----ctattagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||     |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||    
1608692 caagaaagaattaattgaatataggaataaaatattatctattagaaaaaatggtattacttaataatccagaaagttgaagccaaattacttgttattg 1608791  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    ||||||||||||||||| |||||| |||||||||||||| |||| |||||||||||||||||||||||||    
1608792 caagaaaaacaagtgtcttaatgtggattcacatagcaatattcttaagcttacttataaatgcactaat 1608861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1614168 - 1614337
471 caagaaagggttaattgaatatagaaataaaatct-----attagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||||     |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||| ||    
1614168 caagaaagaattaattgaatataggaataaaatcttatctattagaaaaaatggaattacttaataatccagaaagttgaagccaaattacttgttagtg 1614267  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    |||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| ||||||    
1614268 caagaaaaacaagtgtgctaatgtggattcacatagcaacattcttaagcttacttataaatgtactaat 1614337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 510 - 634
Target Start/End: Original strand, 1625737 - 1625862
510 gaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgt-gattcacatagcaacattc 608  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| | ||||||||| |||||||    
1625737 gaaaaaatggtattacttaataattcagaaagttggagcctaattacttgatattgcaagaaaaacaagtgtcctgatgtagcttcacatagaaacattc 1625836  T
609 ataagcttacttataaatgcactaat 634  Q
     || |||||||| | |||||| ||||    
1625837 ttaggcttactttttaatgcattaat 1625862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 381 - 469
Target Start/End: Original strand, 1614032 - 1614125
381 cttatgagaattaagcta---tatgtgcatatata--cttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||||||||||||||||||   ||||||||||||||  | |||||||||||||| ||||||||||| |||||||||| |||||||||||||||||    
1614032 cttatgagaattaagctactatatgtgcatatatatacataaatttttgtaggcggagtgtgaagggtgaaaacgtttggaatgaattgcaagt 1614125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 461
Target Start/End: Original strand, 18786145 - 18786594
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||    
18786145 tgtgcttctttttgcatggtaagagcttggtttaaggctaatttaacaagcatttccctgaattcaactctatgtttgattttgaagtgattgttcattt 18786244  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
18786245 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggctattgagaa 18786344  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataa-ttcaattgtagaataattgaagagtttaaaaatgaaataagagttt 313  Q
    ||| |||||||||||||||||||  ||| |||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||   || ||||||||    
18786345 aattgaagataagaaaaagagcataaacaatgtttttccaatgattgccataatttcagttgtagaataattgaagattttaaaaa-ataacaagagttt 18786443  T
314 gtgttgcat-atacaaatgtgagtatagactatagattatgtttttgttcacttg-----tttttggttttgacttatgagaattaagctatatgtgcat 407  Q
     |||||||| | ||||||||| |        |||||| ||| ||||||| |||||     | |||||||||||||||| |||| ||||||||||||||||    
18786444 atgttgcataaaacaaatgtgtg-------catagatgatgcttttgttgacttggattatatttggttttgacttataagaaataagctatatgtgcat 18786536  T
408 a----tatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaa 461  Q
    |    ||||| | |  |||||||||||||||||||||  ||||||| |||| ||||||    
18786537 atatttatacgtgatattttgtaggtggagtgtgaaggttgaaaacatgtgaaatgaa 18786594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 510 - 589
Target Start/End: Original strand, 18786688 - 18786767
510 gaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgt 589  Q
    |||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
18786688 gaaaaaatagttttacttaataattcagaaagttggagcctaattacttgttattgcaagaaaaacaagtgtcctcatgt 18786767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 198720 times since January 2019
Visitors: 906