View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-11 (Length: 646)

Name: F9285J-LTR4-TNT-insertion-11
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-11
F9285J-LTR4-TNT-insertion-11
[»] chr3 (9 HSPs)
chr3 (7-634)||(10818239-10818866)
chr3 (7-469)||(1608189-1608649)
chr3 (15-469)||(1631687-1632137)
chr3 (15-401)||(1625204-1625579)
chr3 (471-634)||(1632180-1632349)
chr3 (471-634)||(1608692-1608861)
chr3 (471-634)||(1614168-1614337)
chr3 (510-634)||(1625737-1625862)
chr3 (381-469)||(1614032-1614125)
[»] chr7 (2 HSPs)
chr7 (15-461)||(18786145-18786594)
chr7 (510-589)||(18786688-18786767)


Alignment Details
Target: chr3 (Bit Score: 628; Significance: 0; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 628; E-Value: 0
Query Start/End: Original strand, 7 - 634
Target Start/End: Complemental strand, 10818866 - 10818239
Alignment:
7 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818866 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 10818767  T
107 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818766 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 10818667  T
207 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818666 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 10818567  T
307 agagtttgtgttgcatatacaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatatgtgca 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818566 agagtttgtgttgcatatacaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatatgtgca 10818467  T
407 tatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagtacaagaaagggttaattgaatatagaaataaaatcta 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818466 tatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagtacaagaaagggttaattgaatatagaaataaaatcta 10818367  T
507 ttagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgtgattcacatagcaacat 606  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818366 ttagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgtgattcacatagcaacat 10818267  T
607 tcataagcttacttataaatgcactaat 634  Q
    ||||||||||||||||||||||||||||    
10818266 tcataagcttacttataaatgcactaat 10818239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 7 - 469
Target Start/End: Original strand, 1608189 - 1608649
Alignment:
7 aattttcatgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgatt 106  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
1608189 aattttcttgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgatt 1608288  T
107 gttcatttgtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagact 206  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
1608289 gttcatttgtgttgtgtagtgtttgcatggctttggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggct 1608388  T
207 attgagaaaatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaata 306  Q
    ||||||||||| || ||||||||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||    
1608389 attgagaaaattgatgataagaaaaagagcataaacaatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaa-ataata 1608487  T
307 agagtttgtgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaat-------taagcta 398  Q
    ||||||| |||||||||| ||||||||| |        ||| || |||||||||||||||||||||||||||||||||||||||||       ||| ||     
1608488 agagtttatgttgcatataacaaatgtgtg--------atatatgatgtttttgttcacttgtttttggttttgacttatgagaattaaaccctaaactc 1608579  T
399 tatgtgcatatatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||| |  |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
1608580 tatatatatatatacataaatttttgtaggcggagtgtgaag-gtgaaaacgtgtggaatgaattgcaagt 1608649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 15 - 469
Target Start/End: Original strand, 1631687 - 1632137
Alignment:
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
1631687 tgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgattgttcattt 1631786  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||    
1631787 gtgttgtgtagtgtttgcatggctttggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggctgttgagaa 1631886  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaataagagtttg 314  Q
    ||| || ||||||||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||     
1631887 aattgatgataagaaaaagagcataaacaatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaa-ataataagagttta 1631985  T
315 tgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctata-----tgtgcata 408  Q
    |||||||||| ||||||||| |        ||| || |||||||||||||||||||||||||||||||||||||||||||| |  ||     | |  |||    
1631986 tgttgcatataacaaatgtgtg--------atatatgatgtttttgttcacttgtttttggttttgacttatgagaattaaaccctaaactctctatata 1632077  T
409 tatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||||| |||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||    
1632078 tatacataaatttttgtaggcggagtgtgaag-gtgtaaacgtgtggaatgaattgcaagt 1632137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 401
Target Start/End: Original strand, 1625204 - 1625579
Alignment:
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
1625204 tgtgcttctttttgcatggtaagagcttgttttaaggctaattgaacaagcatttccctgaattcaactctatgtttgattttgaaatgattgttcattt 1625303  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| |||||    
1625304 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctattttgctcgaggaaggtccttttcttgatgaggctatggagaa 1625403  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataattcaattgtagaataattgaagagtttaaaaatgaaat-aagagttt 313  Q
    ||| ||||||| ||||| |||||  ||  ||||||||||||||||||||||||||||||||||||||||||||||||||      |||||| ||||||||    
1625404 aattgaagatacgaaaacgagcataaataatgtttttccaatgattgccataattcaattgtagaataattgaagagtt------tgaaataaagagttt 1625497  T
314 gtgttgcatat-acaaatgtgagtatagactatagattatgtttttgttcacttgtttttggttttgacttatgagaattaagctatat 401  Q
     |||||||||| ||||||||| |       |||| || ||| ||| ||| |||||||||||| ||||||||||||||||||| ||||||    
1625498 atgttgcatataacaaatgtgtg-------tataaatgatgctttagttgacttgtttttggatttgacttatgagaattaatctatat 1625579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1632180 - 1632349
Alignment:
471 caagaaagggttaattgaatatagaaataaaatct-----attagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||||     |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
1632180 caagaaagaattaattgaatataggaataaaatcttctctattagaaaaaatggtattacttaacaattcagaaagttgaagcctaattacttgtcattg 1632279  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||    
1632280 caagaaaaacaagtgtcctaatgtggattcacatagcaacattcttaagcttgcttataaatgcactaat 1632349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1608692 - 1608861
Alignment:
471 caagaaagggttaattgaatatagaaataaaat-----ctattagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||     |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||    
1608692 caagaaagaattaattgaatataggaataaaatattatctattagaaaaaatggtattacttaataatccagaaagttgaagccaaattacttgttattg 1608791  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    ||||||||||||||||| |||||| |||||||||||||| |||| |||||||||||||||||||||||||    
1608792 caagaaaaacaagtgtcttaatgtggattcacatagcaatattcttaagcttacttataaatgcactaat 1608861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 1614168 - 1614337
Alignment:
471 caagaaagggttaattgaatatagaaataaaatct-----attagaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattg 565  Q
    ||||||||  |||||||||||||| ||||||||||     |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||| ||    
1614168 caagaaagaattaattgaatataggaataaaatcttatctattagaaaaaatggaattacttaataatccagaaagttgaagccaaattacttgttagtg 1614267  T
566 caagaaaaacaagtgtcctaatgt-gattcacatagcaacattcataagcttacttataaatgcactaat 634  Q
    |||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| ||||||    
1614268 caagaaaaacaagtgtgctaatgtggattcacatagcaacattcttaagcttacttataaatgtactaat 1614337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 510 - 634
Target Start/End: Original strand, 1625737 - 1625862
Alignment:
510 gaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgt-gattcacatagcaacattc 608  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| | ||||||||| |||||||    
1625737 gaaaaaatggtattacttaataattcagaaagttggagcctaattacttgatattgcaagaaaaacaagtgtcctgatgtagcttcacatagaaacattc 1625836  T
609 ataagcttacttataaatgcactaat 634  Q
     || |||||||| | |||||| ||||    
1625837 ttaggcttactttttaatgcattaat 1625862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 381 - 469
Target Start/End: Original strand, 1614032 - 1614125
Alignment:
381 cttatgagaattaagcta---tatgtgcatatata--cttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaattgcaagt 469  Q
    ||||||||||||||||||   ||||||||||||||  | |||||||||||||| ||||||||||| |||||||||| |||||||||||||||||    
1614032 cttatgagaattaagctactatatgtgcatatatatacataaatttttgtaggcggagtgtgaagggtgaaaacgtttggaatgaattgcaagt 1614125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 461
Target Start/End: Original strand, 18786145 - 18786594
Alignment:
15 tgtgcttctttttgcatggtaagagcttggtttaaggctaattgaacaagcatttccctgaattcaattctatgtttgattttgaaatgattgttcattt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||    
18786145 tgtgcttctttttgcatggtaagagcttggtttaaggctaatttaacaagcatttccctgaattcaactctatgtttgattttgaagtgattgttcattt 18786244  T
115 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgagactattgagaa 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
18786245 gtgttgtgtagtgtttgcatggcttaggatgtggtgttaaattgcaccaccaatctatgttgcttgaggaaggtccttttcttgatgaggctattgagaa 18786344  T
215 aatggaagataagaaaaagagcacgaaccatgtttttccaatgattgccataa-ttcaattgtagaataattgaagagtttaaaaatgaaataagagttt 313  Q
    ||| |||||||||||||||||||  ||| |||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||   || ||||||||    
18786345 aattgaagataagaaaaagagcataaacaatgtttttccaatgattgccataatttcagttgtagaataattgaagattttaaaaa-ataacaagagttt 18786443  T
314 gtgttgcat-atacaaatgtgagtatagactatagattatgtttttgttcacttg-----tttttggttttgacttatgagaattaagctatatgtgcat 407  Q
     |||||||| | ||||||||| |        |||||| ||| ||||||| |||||     | |||||||||||||||| |||| ||||||||||||||||    
18786444 atgttgcataaaacaaatgtgtg-------catagatgatgcttttgttgacttggattatatttggttttgacttataagaaataagctatatgtgcat 18786536  T
408 a----tatacttaaatttttgtaggtggagtgtgaagtgtgaaaacgtgtggaatgaa 461  Q
    |    ||||| | |  |||||||||||||||||||||  ||||||| |||| ||||||    
18786537 atatttatacgtgatattttgtaggtggagtgtgaaggttgaaaacatgtgaaatgaa 18786594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 510 - 589
Target Start/End: Original strand, 18786688 - 18786767
Alignment:
510 gaaaaaatggtattacttaataattcagaaagttgaagcctaattacttgttattgcaagaaaaacaagtgtcctaatgt 589  Q
    |||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
18786688 gaaaaaatagttttacttaataattcagaaagttggagcctaattacttgttattgcaagaaaaacaagtgtcctcatgt 18786767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98036 times since January 2019
Visitors: 2269