View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-12 (Length: 359)

Name: F9285J-LTR4-TNT-insertion-12
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-12
[»] chr2 (1 HSPs)
chr2 (9-351)||(18080325-18080667)

Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 9 - 351
Target Start/End: Complemental strand, 18080667 - 18080325
9 caactgctccttcaaaaagtggaagcaaattttctacttcttcaattctcatgaagcgccacagatcttccttctcaatgcacctgatgatttcaacggt 108  Q
18080667 caactgctccttcaaaaagtggaagcaaattttctacttcttcaattctcatgaagcgccacagatcttccttctcaatgcacctgatgatttcaacggt 18080568  T
109 taaacgaaaatatgataagccaattccagaagaatgaatctaaatcacactgcagggaatgtttgcagggcaacaaaatcttacttgcttcctggcttag 208  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
18080567 taaacgaaaatatgataagccaattccagaaaaatgaatctaaatcacattgcagggaatgtttgcagggcaacaaaatcttacttgcttcctggcttag 18080468  T
209 caacattcctgaaaattcgaaacgcagccgccttcgcttcccattcactagtaatttcattatctttgttgtcactcacatcttcatagatgctctctgg 308  Q
18080467 caacattcctgaaaattcgaaacgcagccgccttcgcttcccattcactagtaatttcattatctttgttgtcactcacatcttcatagatgctctctgg 18080368  T
309 tgtatagctaatggtagacaatccagaactcctgatcacatta 351  Q
18080367 tgtatagctaatggtagacaatccagaactcctgatcacatta 18080325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC