View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-12 (Length: 359)

Name: F9285J-LTR4-TNT-insertion-12
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-12
F9285J-LTR4-TNT-insertion-12
[»] chr2 (1 HSPs)
chr2 (9-351)||(18080325-18080667)


Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 9 - 351
Target Start/End: Complemental strand, 18080667 - 18080325
Alignment:
9 caactgctccttcaaaaagtggaagcaaattttctacttcttcaattctcatgaagcgccacagatcttccttctcaatgcacctgatgatttcaacggt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18080667 caactgctccttcaaaaagtggaagcaaattttctacttcttcaattctcatgaagcgccacagatcttccttctcaatgcacctgatgatttcaacggt 18080568  T
109 taaacgaaaatatgataagccaattccagaagaatgaatctaaatcacactgcagggaatgtttgcagggcaacaaaatcttacttgcttcctggcttag 208  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
18080567 taaacgaaaatatgataagccaattccagaaaaatgaatctaaatcacattgcagggaatgtttgcagggcaacaaaatcttacttgcttcctggcttag 18080468  T
209 caacattcctgaaaattcgaaacgcagccgccttcgcttcccattcactagtaatttcattatctttgttgtcactcacatcttcatagatgctctctgg 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18080467 caacattcctgaaaattcgaaacgcagccgccttcgcttcccattcactagtaatttcattatctttgttgtcactcacatcttcatagatgctctctgg 18080368  T
309 tgtatagctaatggtagacaatccagaactcctgatcacatta 351  Q
    |||||||||||||||||||||||||||||||||||||||||||    
18080367 tgtatagctaatggtagacaatccagaactcctgatcacatta 18080325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98628 times since January 2019
Visitors: 2275