View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-2 (Length: 401)

Name: F9285J-LTR4-TNT-insertion-2
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-2
F9285J-LTR4-TNT-insertion-2
[»] chr6 (1 HSPs)
chr6 (9-391)||(1399737-1400119)


Alignment Details
Target: chr6 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 9 - 391
Target Start/End: Original strand, 1399737 - 1400119
Alignment:
9 gaagcaccaacaactctaggattgggcgtgttcccgtggttgacatgcgtcggtgtctgacatccgtacaacatccatacaacaactcagacaagtatgc 108  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1399737 gaagcaccaacaactctaggattgggcgtgttcctgtggttgacatgcgtcggtgtctgacatccgtacaacatccatacaacaactcagacaagtatgc 1399836  T
109 caaaataaaaatatatatacagtggtgttggtgtcctattttctannnnnnnatattagcagtgttgaagtatttgcgtcgtgtctagtgtctgtcggag 208  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||       ||||||||||||||||||||||||||||||||||||||||||||||||    
1399837 caaaataaaaatatatatgcagtggtgttggtgtcctattttttatttttttatattagcagtgttgaagtatttgcgtcgtgtctagtgtctgtcggag 1399936  T
209 tccctgcctcattcgctgaaaactgctcaacgaatgatattacttactttactctattacgtgaactgtccactttaaagagctaaatccatttcaaatg 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1399937 tccctgcctcattcgctgaaaactgctcaacgaatgatattacttactttactctattacgtgaactgtccactttaaagagctaaatccatttcaaatg 1400036  T
309 aacttataatgctcatttgttgattgaaaggttgtttatgctaagctttgaaattggttctacatagttcatggttgttatta 391  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1400037 aacttataatgctcatttgttgattgaaaggttgtttatgctaagctttgaaattggttctacatagttcatggttgttatta 1400119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93565 times since January 2019
Visitors: 2365