View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-2 (Length: 401)

Name: F9285J-LTR4-TNT-insertion-2
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-2
[»] chr6 (1 HSPs)
chr6 (9-391)||(1399737-1400119)

Alignment Details
Target: chr6 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 9 - 391
Target Start/End: Original strand, 1399737 - 1400119
9 gaagcaccaacaactctaggattgggcgtgttcccgtggttgacatgcgtcggtgtctgacatccgtacaacatccatacaacaactcagacaagtatgc 108  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1399737 gaagcaccaacaactctaggattgggcgtgttcctgtggttgacatgcgtcggtgtctgacatccgtacaacatccatacaacaactcagacaagtatgc 1399836  T
109 caaaataaaaatatatatacagtggtgttggtgtcctattttctannnnnnnatattagcagtgttgaagtatttgcgtcgtgtctagtgtctgtcggag 208  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||       ||||||||||||||||||||||||||||||||||||||||||||||||    
1399837 caaaataaaaatatatatgcagtggtgttggtgtcctattttttatttttttatattagcagtgttgaagtatttgcgtcgtgtctagtgtctgtcggag 1399936  T
209 tccctgcctcattcgctgaaaactgctcaacgaatgatattacttactttactctattacgtgaactgtccactttaaagagctaaatccatttcaaatg 308  Q
1399937 tccctgcctcattcgctgaaaactgctcaacgaatgatattacttactttactctattacgtgaactgtccactttaaagagctaaatccatttcaaatg 1400036  T
309 aacttataatgctcatttgttgattgaaaggttgtttatgctaagctttgaaattggttctacatagttcatggttgttatta 391  Q
1400037 aacttataatgctcatttgttgattgaaaggttgtttatgctaagctttgaaattggttctacatagttcatggttgttatta 1400119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC