View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-3 (Length: 483)

Name: F9285J-LTR4-TNT-insertion-3
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-3
F9285J-LTR4-TNT-insertion-3
[»] chr3 (1 HSPs)
chr3 (10-475)||(42884506-42884971)
[»] chr2 (1 HSPs)
chr2 (46-234)||(22984238-22984416)


Alignment Details
Target: chr3 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 10 - 475
Target Start/End: Original strand, 42884506 - 42884971
Alignment:
10 ctggtcacagatatttcgtgatccttttcgggtatctaaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctact 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884506 ctggtcacagatatttcgtgatccttttcgggtatctaaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctact 42884605  T
110 acactctcctcatcaaacctctatttgtctcatttcatttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884606 acactctcctcatcaaacctctatttgtctcatttcatttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttga 42884705  T
210 attcgaacgaaaagaactatatgttcaaacattgacggacatagtaaacactacacttttacgtttaaagagaatcattgaacggaaataaaactatata 309  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884706 attcgaacgaaaagaactatatgttcaaacattgacggatatagtaaacactacacttttacgtttaaagagaatcattgaacggaaataaaactatata 42884805  T
310 attgaactttgatggatatagtaaacacacacttttacgcttataaggaatcataatatcataattatttagtcaaacaaaccactcatcaaaacttgag 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884806 attgaactttgatggatatagtaaacacacacttttacgcttataaggaatcataatatcataattatttagtcaaacaaaccactcatcaaaacttgag 42884905  T
410 gcgctcgttgttttgaataccgataagttaagacatataaagaaaactataaaattaaaattatta 475  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884906 gcgctcgttgttttgaataccgataagttaagacatataaagaaaactataaaattaaaattatta 42884971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 46 - 234
Target Start/End: Complemental strand, 22984416 - 22984238
Alignment:
46 taaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctactacactctcctcatcaaacctctatttgtctcatttc 145  Q
    ||||||||||||||||||||| ||||| |||||     | |||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||     
22984416 taaggatttgattcagtcccctcccctctactc-----attgtattcaataaccaaatcctactacactctcatcatcaaatctctatctgtctcatttg 22984322  T
146 atttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttgaattcgaacgaaaagaactatatgtt 234  Q
    ||||| |||||| |||||||||||||||||||||| ||||||||||||||     ||||||| ||||||||| |||| |||||||||||    
22984321 atttgtatatgg-ttagttgtttgacctaaacctagagaagtttgaggtc----ttaggtttaaattcgaaccaaaaaaactatatgtt 22984238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC