View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-3 (Length: 483)

Name: F9285J-LTR4-TNT-insertion-3
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-3
[»] chr3 (1 HSPs)
chr3 (10-475)||(42884506-42884971)
[»] chr2 (1 HSPs)
chr2 (46-234)||(22984238-22984416)

Alignment Details
Target: chr3 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 10 - 475
Target Start/End: Original strand, 42884506 - 42884971
10 ctggtcacagatatttcgtgatccttttcgggtatctaaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctact 109  Q
42884506 ctggtcacagatatttcgtgatccttttcgggtatctaaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctact 42884605  T
110 acactctcctcatcaaacctctatttgtctcatttcatttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttga 209  Q
42884606 acactctcctcatcaaacctctatttgtctcatttcatttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttga 42884705  T
210 attcgaacgaaaagaactatatgttcaaacattgacggacatagtaaacactacacttttacgtttaaagagaatcattgaacggaaataaaactatata 309  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42884706 attcgaacgaaaagaactatatgttcaaacattgacggatatagtaaacactacacttttacgtttaaagagaatcattgaacggaaataaaactatata 42884805  T
310 attgaactttgatggatatagtaaacacacacttttacgcttataaggaatcataatatcataattatttagtcaaacaaaccactcatcaaaacttgag 409  Q
42884806 attgaactttgatggatatagtaaacacacacttttacgcttataaggaatcataatatcataattatttagtcaaacaaaccactcatcaaaacttgag 42884905  T
410 gcgctcgttgttttgaataccgataagttaagacatataaagaaaactataaaattaaaattatta 475  Q
42884906 gcgctcgttgttttgaataccgataagttaagacatataaagaaaactataaaattaaaattatta 42884971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 46 - 234
Target Start/End: Complemental strand, 22984416 - 22984238
46 taaggatttgattcagtccccacccctgtactctttgtaatgtattcaataaccaaatcctactacactctcctcatcaaacctctatttgtctcatttc 145  Q
    ||||||||||||||||||||| ||||| |||||     | |||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||     
22984416 taaggatttgattcagtcccctcccctctactc-----attgtattcaataaccaaatcctactacactctcatcatcaaatctctatctgtctcatttg 22984322  T
146 atttgcatatggtttagttgtttgacctaaacctaaagaagtttgaggtcctagctaggtttgaattcgaacgaaaagaactatatgtt 234  Q
    ||||| |||||| |||||||||||||||||||||| ||||||||||||||     ||||||| ||||||||| |||| |||||||||||    
22984321 atttgtatatgg-ttagttgtttgacctaaacctagagaagtttgaggtc----ttaggtttaaattcgaaccaaaaaaactatatgtt 22984238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199800 times since January 2019
Visitors: 908