View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-4 (Length: 173)

Name: F9285J-LTR4-TNT-insertion-4
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-4
F9285J-LTR4-TNT-insertion-4
[»] chr7 (1 HSPs)
chr7 (9-163)||(8028257-8028411)
[»] scaffold0405 (1 HSPs)
scaffold0405 (9-84)||(14328-14403)
[»] chr8 (1 HSPs)
chr8 (86-163)||(770558-770636)
[»] chr4 (1 HSPs)
chr4 (9-84)||(27349996-27350070)
[»] chr1 (1 HSPs)
chr1 (86-163)||(51389416-51389497)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 1e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 9 - 163
Target Start/End: Complemental strand, 8028411 - 8028257
Alignment:
9 ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttctttctttatggattttcatttgcgagg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8028411 ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttctttctttatggattttcatttgcgagg 8028312  T
109 atttaagcccctggtttgggttgtttgctgactattttcctggattatgtgatta 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8028311 atttaagcccctggtttgggttgtttgctgactattttcctggattatgtgatta 8028257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0405 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: scaffold0405
Description:

Target: scaffold0405; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 14403 - 14328
Alignment:
9 ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttcttt 84  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
14403 ctttgttgcaggtgggaacatttatttatgtttgtgaaaccgtgtttttgtttggtaatttgagcttagtttcttt 14328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 86 - 163
Target Start/End: Original strand, 770558 - 770636
Alignment:
86 tttatggattttcatttgcgaggatttaagcccctggtttgggttgtttgctgacta-ttttcctggattatgtgatta 163  Q
    ||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||    
770558 tttatggatttgcatttgcgagaatttaagcccctggtttgggttttttgctgactatttttcctggattatgtgatta 770636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 9 - 84
Target Start/End: Original strand, 27349996 - 27350070
Alignment:
9 ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttcttt 84  Q
    |||||||||||||| ||||||| |||||||||||||||  | ||||||||||||||||||| ||||||||||||||    
27349996 ctttgttgcaggtgggaacatt-atttatgtttgtgaatgcatgttttagtttggtaatttcagcttagtttcttt 27350070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 86 - 163
Target Start/End: Complemental strand, 51389497 - 51389416
Alignment:
86 tttatggattttcatttgcgaggatttaagcccctggtttggg---ttgtttgctgacta-ttttcctggattatgtgatta 163  Q
    ||||||||||| |||||||||| ||||||||||||||||||||   || ||||||||||| ||||| |||||||||||||||    
51389497 tttatggatttgcatttgcgagaatttaagcccctggtttgggtttttttttgctgactatttttcatggattatgtgatta 51389416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199847 times since January 2019
Visitors: 908