View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-5 (Length: 123)

Name: F9285J-LTR4-TNT-insertion-5
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-5
F9285J-LTR4-TNT-insertion-5
[»] chr4 (2 HSPs)
chr4 (34-114)||(504935-505015)
chr4 (7-39)||(421452-421484)
[»] chr7 (1 HSPs)
chr7 (34-114)||(6928867-6928947)
[»] chr6 (1 HSPs)
chr6 (34-114)||(14541432-14541512)
[»] chr3 (1 HSPs)
chr3 (34-114)||(53091850-53091930)
[»] scaffold0002 (1 HSPs)
scaffold0002 (48-113)||(166591-166656)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 505015 - 504935
Alignment:
34 gaattccaaaaggaccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
505015 gaattccaaaaggaccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 504935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 421452 - 421484
Alignment:
7 aattcttacattgtatcagccagtgttgaattc 39  Q
    |||||||||||||||||||||||||||||||||    
421452 aattcttacattgtatcagccagtgttgaattc 421484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 6928947 - 6928867
Alignment:
34 gaattccaaaaggaccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 114  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6928947 gaattccaaaaggaccggcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 6928867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 14541512 - 14541432
Alignment:
34 gaattccaaaaggaccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 114  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14541512 gaattccaaaaggactagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 14541432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 69; Significance: 2e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 34 - 114
Target Start/End: Original strand, 53091850 - 53091930
Alignment:
34 gaattccaaaaggaccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaattg 114  Q
    |||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||    
53091850 gaattccaaaaggaccggcgtattcgggtccaatacgatgttgtatccctgcaaatatttctctttctaaccatacaattg 53091930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 48 - 113
Target Start/End: Complemental strand, 166656 - 166591
Alignment:
48 ccagcgtattcgggtccaatacgctgttgtatccctgcagatatttctctttctaaccatacaatt 113  Q
    ||||| ||||| || |||||||| |||||||||   ||||||||||||||||||||||| ||||||    
166656 ccagcatattcaggaccaatacgttgttgtatcgacgcagatatttctctttctaaccacacaatt 166591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199547 times since January 2019
Visitors: 907