View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-7 (Length: 179)

Name: F9285J-LTR4-TNT-insertion-7
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-7
F9285J-LTR4-TNT-insertion-7
[»] chr2 (4 HSPs)
chr2 (9-169)||(39749225-39749385)
chr2 (9-169)||(27019741-27019901)
chr2 (9-169)||(27088516-27088676)
chr2 (13-166)||(26978013-26978166)
[»] chr4 (1 HSPs)
chr4 (9-169)||(1960232-1960392)
[»] chr8 (1 HSPs)
chr8 (9-169)||(11631582-11631742)
[»] chr6 (1 HSPs)
chr6 (13-169)||(34680410-34680566)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 4e-86; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 39749385 - 39749225
Alignment:
9 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39749385 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 39749286  T
109 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39749285 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 39749225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 9 - 169
Target Start/End: Original strand, 27019741 - 27019901
Alignment:
9 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 108  Q
    ||||||||||||||||||||||| ||||| ||||||||| |||||||||| ||||| | ||||||||| |||| ||| |||||||  |||||| |  |||    
27019741 ttggctgctgatgagaaaaggtcgagattggcttggcatctaagtgattgctttcaaagggattctggaagggtttcctttcctcgctgtgacgcagaaa 27019840  T
109 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    |||||||| |  ||||||||||||||||||| || ||||||||||| ||||||||||||||    
27019841 catcaattgcaacatgcctaagaaacttagacgatcttgctcataaggtttaccttgaatt 27019901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 77; E-Value: 5e-36
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 27088676 - 27088516
Alignment:
9 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 108  Q
    ||||||||||| ||||||||||| ||||| ||||||||| |||||||||| ||||| | ||||||||| |||| ||| ||||||| ||||||| |  |||    
27088676 ttggctgctgacgagaaaaggtcgagattggcttggcatctaagtgattgctttcaaagggattctggaagggtttcctttcctcgttgtgacgcagaaa 27088577  T
109 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    || ||||| |  ||||||||||||||||||| || ||||||||||| ||||||||||||||    
27088576 caccaattgcaacatgcctaagaaacttagacgatcttgctcataaggtttaccttgaatt 27088516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 13 - 166
Target Start/End: Original strand, 26978013 - 26978166
Alignment:
13 ctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaacatc 112  Q
    |||| |||||||||||||| ||||| ||||||||| |||||||||| ||||| | ||||||||| |||| ||| ||||||| ||||||| ||||||||||    
26978013 ctgcagatgagaaaaggtcgagattggcttggcatctaagtgattgctttcaaagggattctggaagggtttcctttcctcattgtgacacgaaaacatc 26978112  T
113 aatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttga 166  Q
    |||| |  ||||||| |||||||| || ||  | |||||||| |||||||||||    
26978113 aattgcgacatgccttagaaacttggacgatttcgctcataaggtttaccttga 26978166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 117; Significance: 7e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 7e-60
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 1960392 - 1960232
Alignment:
9 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||| |||| |||| ||||    
1960392 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagatggattctggcaggacttcctttcctcattgtaactcaaaaa 1960293  T
109 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    || |||||||| |||| |||| |||||||||||||||||||||||||||| ||||||||||    
1960292 caccaatttctacatgtctaataaacttagatgaccttgctcataaagttaaccttgaatt 1960232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 6e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 6e-48
Query Start/End: Original strand, 9 - 169
Target Start/End: Original strand, 11631582 - 11631742
Alignment:
9 ttggctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaa 108  Q
    |||||||| |||||||||||||||||||||||||||||| |||||||||| ||||| | ||||||||| |||| ||| ||||||| ||||||||| ||||    
11631582 ttggctgccgatgagaaaaggtctagattagcttggcatctaagtgattgctttcaaagggattctggaagggattcctttcctcattgtgactcaaaaa 11631681  T
109 catcaatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    |||||||| |   |||| |||||||||||||||||||||||||||| ||||||||||||||    
11631682 catcaattgcaaaatgcttaagaaacttagatgaccttgctcataaggtttaccttgaatt 11631742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 13 - 169
Target Start/End: Original strand, 34680410 - 34680566
Alignment:
13 ctgctgatgagaaaaggtctagattagcttggcatttaagtgattgttttcagaaggattctggcagggcttcgtttcctctttgtgactcgaaaacatc 112  Q
    |||| |||||||||||||| ||||| ||||||||| |||||||||| ||||| | ||||||||| |||| ||| ||||||| ||||||| ||||||||||    
34680410 ctgcggatgagaaaaggtcgagattggcttggcatctaagtgattgctttcaaagggattctggaagggtttcctttcctcattgtgacacgaaaacatc 34680509  T
113 aatttcttcatgcctaagaaacttagatgaccttgctcataaagtttaccttgaatt 169  Q
    ||||    ||||||||||||||||||| || ||||||||||| ||||||||||||||    
34680510 aattgtgacatgcctaagaaacttagacgatcttgctcataaggtttaccttgaatt 34680566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199802 times since January 2019
Visitors: 908