View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-8 (Length: 232)

Name: F9285J-LTR4-TNT-insertion-8
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-8
F9285J-LTR4-TNT-insertion-8
[»] chr6 (1 HSPs)
chr6 (8-232)||(19706682-19706906)
[»] chr5 (2 HSPs)
chr5 (10-154)||(23192699-23192843)
chr5 (178-223)||(23192602-23192648)


Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 19706682 - 19706906
Alignment:
8 tgcctctatttagattcaaatttgaatagagtagatggaaaataagcacacaattttttgttttgcatttctattctattgttcaaaaaagttaattttt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19706682 tgcctctatttagattcaaatttgaatagagtagatggaaaataagcacacaattttttgttttgcatttctattctattgttcaaaaaagttaattttt 19706781  T
108 aaaagccaacctttcttagtaccaaaccaagagatccccatttatcaannnnnnnnnnnnnnnnnnnnataagttttatatattactcttctacatgggg 207  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||                    |||||||||||||||||||||||||||||| |    
19706782 aaaagccaacctttcttagtaccaaaccaagagatctccatttatcaattttttttttttttttttttataagttttatatattactcttctacatggtg 19706881  T
208 ttaaataattatattttatgtatga 232  Q
    |||||||||||||||||||||||||    
19706882 ttaaataattatattttatgtatga 19706906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 154
Target Start/End: Complemental strand, 23192843 - 23192699
Alignment:
10 cctctatttagattcaaatttgaatagagtagatggaaaataagcacacaattttttgttttgcatttctattctattgttcaaaaa-agttaattttta 108  Q
    ||||||| |||||||||||||||||||||||| || ||||||||||||||||||| |||||| ||||||||||| |||||| ||||| |  |||   |||    
23192843 cctctatatagattcaaatttgaatagagtagttgcaaaataagcacacaattttctgtttttcatttctattccattgttaaaaaataaataa-aatta 23192745  T
109 aaagccaacctttcttagtaccaaaccaagagatccccatttatca 154  Q
    |||||||||||||||||||| |||||||||| ||| | ||||||||    
23192744 aaagccaacctttcttagtatcaaaccaagatatctctatttatca 23192699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 223
Target Start/End: Complemental strand, 23192648 - 23192602
Alignment:
178 aagttttatatattactctt-ctacatggggttaaataattatattt 223  Q
    |||| ||||||||||||||| |||||||| |||||||||||||||||    
23192648 aagtattatatattactctttctacatggtgttaaataattatattt 23192602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98241 times since January 2019
Visitors: 2271