View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-9 (Length: 482)

Name: F9285J-LTR4-TNT-insertion-9
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9285J-LTR4-TNT-insertion-9
[»] chr1 (15 HSPs)
chr1 (8-472)||(47770426-47770890)
chr1 (120-339)||(47774467-47774686)
chr1 (115-259)||(47711875-47712019)
chr1 (115-314)||(47744390-47744589)
chr1 (115-259)||(47716626-47716770)
chr1 (115-265)||(47758773-47758923)
chr1 (104-273)||(6524925-6525094)
chr1 (110-271)||(6511011-6511172)
chr1 (110-226)||(6515434-6515550)
chr1 (101-271)||(6498063-6498233)
chr1 (115-229)||(47689803-47689917)
chr1 (420-471)||(47774336-47774387)
chr1 (110-256)||(6503391-6503537)
chr1 (423-468)||(47712167-47712212)
chr1 (425-467)||(47744717-47744759)
[»] chr5 (9 HSPs)
chr5 (107-307)||(27369129-27369329)
chr5 (115-271)||(28829285-28829441)
chr5 (115-273)||(28854962-28855120)
chr5 (115-273)||(28860321-28860479)
chr5 (115-273)||(28874891-28875049)
chr5 (418-472)||(27369430-27369484)
chr5 (420-471)||(28829754-28829805)
chr5 (425-471)||(28855459-28855505)
chr5 (425-471)||(28860665-28860711)
[»] scaffold0341 (2 HSPs)
scaffold0341 (110-271)||(12692-12852)
scaffold0341 (126-256)||(5089-5219)
[»] chr3 (1 HSPs)
chr3 (219-271)||(36067460-36067512)

Alignment Details
Target: chr1 (Bit Score: 431; Significance: 0; HSPs: 15)
Name: chr1

Target: chr1; HSP #1
Raw Score: 431; E-Value: 0
Query Start/End: Original strand, 8 - 472
Target Start/End: Complemental strand, 47770890 - 47770426
8 ggatctacttataaccaagatcatatgagtttcaaatttgatttagtcgttagtaatttgtcttataagtaattgtgtatcattctaactatgtagatat 107  Q
47770890 ggatctacttataaccaagatcatatgagtttcaaatttgatttagtcgttagtaatttgtcttataagtaattgtgtatcattctaactatgtagatat 47770791  T
108 tcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaa 207  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47770790 tcaaacgtaccaaatatgaagtaatcaagacttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaa 47770691  T
208 ctaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcat 307  Q
47770690 ctaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcat 47770591  T
308 ttgtccatcaggaagcttcccctgaaatatataaaggtatagtaaattatannnnnnnnnnctatgataatattttgcagaagatgatattttcatgaat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||    
47770590 ttgtccatcaggaagcttcccctgaaatatataaaggtatagtaaattatattttttttttctatgataatattttgcagaagatgatattttcatgaat 47770491  T
408 aattgaaatgggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 472  Q
47770490 aattgaaatgggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 47770426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 120 - 339
Target Start/End: Complemental strand, 47774686 - 47774467
120 aatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatttcgat 219  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||| ||| |||| ||||||||||||||||||||||| || ||||||||||||||||    
47774686 aatatgaagtaatcaagacttttatttgtaacatattcataaataagcagtttttctctcccttctaaactgaaaccaagtagcctaactaaatttcgat 47774587  T
220 gttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcatttgtccatcagg 319  Q
    ||||||| ||||||||||| | |||||||||||||||||||||||||||||||   ||||||||  |||||||||| || |||||||||||||||| |||    
47774586 gttgaagtttggctactaaaagtacttcatttttaaattccacatctccttggtcagaatctttggacaatcttttgaccgcaatcatttgtccattagg 47774487  T
320 aagcttcccctgaaatatat 339  Q
     ||||| |||||||||||||    
47774486 gagcttgccctgaaatatat 47774467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 115 - 259
Target Start/End: Original strand, 47711875 - 47712019
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||||||||||| ||||| | |||||| || ||||||| ||  |||||||| ||||||||||||||    
47711875 taccaaatataaaataatcaagacttttattcggaacaaattcatagataagcaatctttctcttccttctagacaaaaaccaagtagtctaactaaatt 47711974  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattc 259  Q
    ||||||||||||||| || ||||| |  |||||||| ||||||||    
47711975 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattc 47712019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 115 - 314
Target Start/End: Original strand, 47744390 - 47744589
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||||| |||| ||||||| | ||| | |||||| || ||||||| ||  |||||||| ||||||||||||||    
47744390 taccaaatataaaataatcaagacttttatttggaacatattcatagacaagcaatctttctcttccttctagacaaaaaccaagtagtctaactaaatt 47744489  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcatttgtcca 314  Q
    ||||||||||||||| || ||||| |  |||||||| |||||||| | ||| ||||| |  |||| | || |||| ||||| || ||||||| |||||||    
47744490 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattcaatatccccttgtcctgaatttgttgacaaccttttgaccgcaatcacttgtcca 47744589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 115 - 259
Target Start/End: Original strand, 47716626 - 47716770
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||||||||||| | ||| | |||||| || ||||||| ||  |||||||| |||| |||||||||    
47716626 taccaaatataaaataatcaagacttttattaggaacaaattcatagaaaagcaatctttctcttccttctagacaaaaaccaagtagtcaaactaaatt 47716725  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattc 259  Q
    ||||||||||||||| || ||||| |  |||||||| ||||||||    
47716726 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattc 47716770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 115 - 265
Target Start/End: Original strand, 47758773 - 47758923
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||| ||||||||| ||| | |||||| || ||||| | ||  |||||||| |||| |||||||||    
47758773 taccaaatataaaataatcaagacttttattcggaacatattcataaacaagcaatctttctcttccttccagacaaaaaccaagtagtcgaactaaatt 47758872  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatc 265  Q
    ||||||||||||||| || ||||| |  |||||||| |||||||| |||||    
47758873 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattcaacatc 47758923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 104 - 273
Target Start/End: Complemental strand, 6525094 - 6524925
104 atattcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagt 203  Q
    ||||| |||| ||||||| | ||||||||| ||  | |||||   |||||||||||| | ||| |||||||| || ||||||| || ||||||||| ||     
6525094 atattaaaacctaccaaaaaggaagtaatcgaggctcttattctgaacaaattcatatacaagtagtctttctcttccttctatacagaaaccaagtagc 6524995  T
204 ctaactaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
    |||||||| |||||||||||||| || || ||||| | ||||||||| |||||||| | |||||||||||    
6524994 ctaactaagtttcgatgttgaagtttagccactaaaactacttcattcttaaattctaaatctccttggc 6524925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 110 - 271
Target Start/End: Original strand, 6511011 - 6511172
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| ||||| |||||||| || |||||||  | |||||| || | ||| |||    
6511011 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcatatataagtagtctttctcttccttctaggcagaaaccgagtaatcttact 6511110  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||| |||||||| || || ||||| ||||||||||| ||||| || | |||||||||    
6511111 aaatttcggtgttgaagtttagccactaaaaatacttcattcttaaactctagatctccttg 6511172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 110 - 226
Target Start/End: Original strand, 6515434 - 6515550
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| || || ||||| |||||||||||||||||||  | |||||| || | |||||||    
6515434 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcgtatataagtagtctttcactcccttctaggcagaaaccgagtaatctaact 6515533  T
210 aaatttcgatgttgaag 226  Q
    |||||||| ||||||||    
6515534 aaatttcggtgttgaag 6515550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 271
Target Start/End: Original strand, 6498063 - 6498233
101 tagatattcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaaga 200  Q
    |||||||| |||| ||||||| ||||| ||||| ||| |||| |||  |||||||||||| | ||| | |||||| || |||||||    |||||| ||     
6498063 tagatattaaaacttaccaaaaatgaaataatcgagacttttgttttgaacaaattcatatacaagtactctttctcttccttctagtgagaaaccgagt 6498162  T
201 agtctaactaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    ||||||||||||||||| ||||||||||| || || || | ||| ||||| ||||| |||  |||||||||    
6498163 agtctaactaaatttcggtgttgaagcttagccaccaaaagtacctcattcttaaactccgaatctccttg 6498233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 115 - 229
Target Start/End: Complemental strand, 47689917 - 47689803
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    ||||||||||||  ||||||||| ||||||| |  ||||| |||||||| || |||||||| ||   || ||||| |||||| || ||| ||||||||||    
47689917 taccaaatatgatataatcaagacttttattggagacaaactcataaattagtagtctttctcttttttgtaaacagaaacctagtagtttaactaaatt 47689818  T
215 tcgatgttgaagctt 229  Q
47689817 tcgatgttgaagctt 47689803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 420 - 471
Target Start/End: Complemental strand, 47774387 - 47774336
420 tatcttacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    ||||||||||||||||||||||| || || ||||| ||||||||||||||||    
47774387 tatcttacccgataaacaactccgaacccaccttgtccaagtttattagaat 47774336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 256
Target Start/End: Original strand, 6503391 - 6503537
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| | |||||||||||| || |||||||  |  ||||| || | |||||||    
6503391 aaacctaccaaaaataaagtaatcaagacttttattacaaacaaactcatatacaagaagtctttctcttccttctaggcaaaaaccgagtaatctaact 6503490  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaa 256  Q
    | |||||  |||||||| || || ||||| || |||||||| |||||    
6503491 agatttctgtgttgaagtttagcaactaaaaacacttcattcttaaa 6503537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 423 - 468
Target Start/End: Original strand, 47712167 - 47712212
423 cttacccgataaacaactccaaatccgccttgcccaagtttattag 468  Q
    |||||| |||||||||||||||||||||| || |||||||||||||    
47712167 cttacctgataaacaactccaaatccgccatgtccaagtttattag 47712212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 467
Target Start/End: Original strand, 47744717 - 47744759
425 tacccgataaacaactccaaatccgccttgcccaagtttatta 467  Q
    |||| |||||||||||||||||||||| || ||||||||||||    
47744717 tacctgataaacaactccaaatccgccatgtccaagtttatta 47744759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 109; Significance: 1e-54; HSPs: 9)
Name: chr5

Target: chr5; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 107 - 307
Target Start/End: Original strand, 27369129 - 27369329
107 ttcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtcta 206  Q
    ||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||| |||||||||| || ||||||||| || |||    
27369129 ttcaaacttaccaaatatgaagtaatcaagacttttatttgaaacaaattcataaataagtagtctttctctcccttctagacagaaaccaagtagccta 27369228  T
207 actaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatca 306  Q
    |||| ||||||||||||||| ||||||||||| | ||||||||||||||| || ||||||||||||   |||| | || |||| ||||| ||||||||||    
27369229 actagatttcgatgttgaagtttggctactaaaagtacttcatttttaaactcaacatctccttggtcagaatttgttgacaaccttttcacagcaatca 27369328  T
307 t 307  Q
27369329 t 27369329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 115 - 271
Target Start/End: Original strand, 28829285 - 28829441
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | |||||||||||| | ||| | |||||| |||||||| | | | |||||||| ||||||||||||||    
28829285 taccaaatatgaagtagtcaagacttttattaggaacaaattcatagacaagtaatctttctctcccttcaacagtaaaaccaaggagtctaactaaatt 28829384  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    ||| |||||||| ||||| || ||   |||||| || |||||||| | |||||||||    
28829385 tcggtgttgaagtttggccaccaaacgtacttcgttcttaaattctagatctccttg 28829441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28854962 - 28855120
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | |||||||||||| |  || |||||||| |||||||| | | | |||||||| |  |||||||||||    
28854962 taccaaatatgaagtagtcaagacttttattgggaacaaattcatagactagtagtctttctctcccttcgatagtaaaaccaagtaacctaactaaatt 28855061  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
    | |||||||||| || || |  || | || |||||| |||||||||| |||||||||||    
28855062 ttgatgttgaagtttagccatcaagattaattcattcttaaattccagatctccttggc 28855120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28860321 - 28860479
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | || ||||||||| | ||| |||||||| |||||||| | | | |||||||| ||||||||||||||    
28860321 taccaaatatgaagtagtcaagacttttattgggaataaattcatagacaagtagtctttctctcccttcaatagtaaaaccaagtagtctaactaaatt 28860420  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
     || |||||||| ||||| | ||| |  |||||||| ||||| ||   |||||||||||    
28860421 ccggtgttgaagtttggccattaaaagcacttcattcttaaactctctatctccttggc 28860479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28874891 - 28875049
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||| ||||||||||| || ||| ||||||| | || ||||||||| | ||| |||||||| |||||||| | | | |||||||| |||||||| |||||    
28874891 taccgaatatgaagtagtctagacttttattgggaataaattcatagacaagtagtctttctctcccttcaatagtaaaaccaagtagtctaaccaaatt 28874990  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
     || |||||||| ||||| | ||| |  |||||||| |||||||| | |||||||||||    
28874991 ccggtgttgaagtttggccattaaaagcacttcattcttaaattctatatctccttggc 28875049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 418 - 472
Target Start/End: Original strand, 27369430 - 27369484
418 ggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 472  Q
    |||||| |||||||||||||| ||||||||| ||||| |||||||||||||||||    
27369430 ggtatcatacccgataaacaattccaaatccaccttgtccaagtttattagaatt 27369484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 420 - 471
Target Start/End: Original strand, 28829754 - 28829805
420 tatcttacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    ||||| ||| |||||||| |||||||||| ||||||||||||||||||||||    
28829754 tatctcacctgataaacagctccaaatccaccttgcccaagtttattagaat 28829805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 471
Target Start/End: Original strand, 28855459 - 28855505
425 tacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    |||| |||||||| |||||||||||||||  ||||||||||||||||    
28855459 tacctgataaacagctccaaatccgccttcgccaagtttattagaat 28855505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 471
Target Start/End: Original strand, 28860665 - 28860711
425 tacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    |||| |||| ||| ||||||||||||||| |||||||||||||||||    
28860665 tacctgatatacagctccaaatccgccttccccaagtttattagaat 28860711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0341

Target: scaffold0341; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 110 - 271
Target Start/End: Original strand, 12692 - 12852
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| ||||| |||||||| || |||||||  | |||||| || | ||| |||    
12692 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcatatataagtagtctttctcttccttctaggcagaaaccgagtaatcttact 12791  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||| |||||||| || || ||||| ||||||||||| ||||| || | |||||||||    
12792 aaatttcggtgttgaagtttagccactaa-aatacttcattcttaaactctagatctccttg 12852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 256
Target Start/End: Original strand, 5089 - 5219
126 aagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatttcgatgttgaa 225  Q
    |||||||||||| |||||||   |||||| ||||| | |||||||||||| || |||||||  |  ||||| || | |||||||| |||||  |||||||    
5089 aagtaatcaagacttttattacaaacaaactcatatacaagaagtctttctcttccttctaggcaaaaaccgagtaatctaactagatttctgtgttgaa 5188  T
226 gcttggctactaataatacttcatttttaaa 256  Q
    | || || ||||| || |||||||| |||||    
5189 gtttagcaactaaaaacacttcattcttaaa 5219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 271
Target Start/End: Original strand, 36067460 - 36067512
219 tgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||||||||||| ||| ||||| ||||| |||||||||||| |||||||    
36067460 tgttgaagcttggctattaacaatacctcattcttaaattccacagctccttg 36067512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199625 times since January 2019
Visitors: 907