View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9285J-LTR4-TNT-insertion-9 (Length: 482)

Name: F9285J-LTR4-TNT-insertion-9
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9285J-LTR4-TNT-insertion-9
F9285J-LTR4-TNT-insertion-9
[»] chr1 (15 HSPs)
chr1 (8-472)||(47770426-47770890)
chr1 (120-339)||(47774467-47774686)
chr1 (115-259)||(47711875-47712019)
chr1 (115-314)||(47744390-47744589)
chr1 (115-259)||(47716626-47716770)
chr1 (115-265)||(47758773-47758923)
chr1 (104-273)||(6524925-6525094)
chr1 (110-271)||(6511011-6511172)
chr1 (110-226)||(6515434-6515550)
chr1 (101-271)||(6498063-6498233)
chr1 (115-229)||(47689803-47689917)
chr1 (420-471)||(47774336-47774387)
chr1 (110-256)||(6503391-6503537)
chr1 (423-468)||(47712167-47712212)
chr1 (425-467)||(47744717-47744759)
[»] chr5 (9 HSPs)
chr5 (107-307)||(27369129-27369329)
chr5 (115-271)||(28829285-28829441)
chr5 (115-273)||(28854962-28855120)
chr5 (115-273)||(28860321-28860479)
chr5 (115-273)||(28874891-28875049)
chr5 (418-472)||(27369430-27369484)
chr5 (420-471)||(28829754-28829805)
chr5 (425-471)||(28855459-28855505)
chr5 (425-471)||(28860665-28860711)
[»] scaffold0341 (2 HSPs)
scaffold0341 (110-271)||(12692-12852)
scaffold0341 (126-256)||(5089-5219)
[»] chr3 (1 HSPs)
chr3 (219-271)||(36067460-36067512)


Alignment Details
Target: chr1 (Bit Score: 431; Significance: 0; HSPs: 15)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 431; E-Value: 0
Query Start/End: Original strand, 8 - 472
Target Start/End: Complemental strand, 47770890 - 47770426
Alignment:
8 ggatctacttataaccaagatcatatgagtttcaaatttgatttagtcgttagtaatttgtcttataagtaattgtgtatcattctaactatgtagatat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47770890 ggatctacttataaccaagatcatatgagtttcaaatttgatttagtcgttagtaatttgtcttataagtaattgtgtatcattctaactatgtagatat 47770791  T
108 tcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaa 207  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47770790 tcaaacgtaccaaatatgaagtaatcaagacttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaa 47770691  T
208 ctaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcat 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47770690 ctaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcat 47770591  T
308 ttgtccatcaggaagcttcccctgaaatatataaaggtatagtaaattatannnnnnnnnnctatgataatattttgcagaagatgatattttcatgaat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||    
47770590 ttgtccatcaggaagcttcccctgaaatatataaaggtatagtaaattatattttttttttctatgataatattttgcagaagatgatattttcatgaat 47770491  T
408 aattgaaatgggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 472  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47770490 aattgaaatgggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 47770426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 120 - 339
Target Start/End: Complemental strand, 47774686 - 47774467
Alignment:
120 aatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatttcgat 219  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||| ||| |||| ||||||||||||||||||||||| || ||||||||||||||||    
47774686 aatatgaagtaatcaagacttttatttgtaacatattcataaataagcagtttttctctcccttctaaactgaaaccaagtagcctaactaaatttcgat 47774587  T
220 gttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcatttgtccatcagg 319  Q
    ||||||| ||||||||||| | |||||||||||||||||||||||||||||||   ||||||||  |||||||||| || |||||||||||||||| |||    
47774586 gttgaagtttggctactaaaagtacttcatttttaaattccacatctccttggtcagaatctttggacaatcttttgaccgcaatcatttgtccattagg 47774487  T
320 aagcttcccctgaaatatat 339  Q
     ||||| |||||||||||||    
47774486 gagcttgccctgaaatatat 47774467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 115 - 259
Target Start/End: Original strand, 47711875 - 47712019
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||||||||||| ||||| | |||||| || ||||||| ||  |||||||| ||||||||||||||    
47711875 taccaaatataaaataatcaagacttttattcggaacaaattcatagataagcaatctttctcttccttctagacaaaaaccaagtagtctaactaaatt 47711974  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattc 259  Q
    ||||||||||||||| || ||||| |  |||||||| ||||||||    
47711975 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattc 47712019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 115 - 314
Target Start/End: Original strand, 47744390 - 47744589
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||||| |||| ||||||| | ||| | |||||| || ||||||| ||  |||||||| ||||||||||||||    
47744390 taccaaatataaaataatcaagacttttatttggaacatattcatagacaagcaatctttctcttccttctagacaaaaaccaagtagtctaactaaatt 47744489  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatcatttgtcca 314  Q
    ||||||||||||||| || ||||| |  |||||||| |||||||| | ||| ||||| |  |||| | || |||| ||||| || ||||||| |||||||    
47744490 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattcaatatccccttgtcctgaatttgttgacaaccttttgaccgcaatcacttgtcca 47744589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 115 - 259
Target Start/End: Original strand, 47716626 - 47716770
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||||||||||| | ||| | |||||| || ||||||| ||  |||||||| |||| |||||||||    
47716626 taccaaatataaaataatcaagacttttattaggaacaaattcatagaaaagcaatctttctcttccttctagacaaaaaccaagtagtcaaactaaatt 47716725  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattc 259  Q
    ||||||||||||||| || ||||| |  |||||||| ||||||||    
47716726 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattc 47716770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 115 - 265
Target Start/End: Original strand, 47758773 - 47758923
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||| || ||||||||| ||||||| | |||| ||||||||| ||| | |||||| || ||||| | ||  |||||||| |||| |||||||||    
47758773 taccaaatataaaataatcaagacttttattcggaacatattcataaacaagcaatctttctcttccttccagacaaaaaccaagtagtcgaactaaatt 47758872  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatc 265  Q
    ||||||||||||||| || ||||| |  |||||||| |||||||| |||||    
47758873 tcgatgttgaagcttagcgactaaaagcacttcattcttaaattcaacatc 47758923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 104 - 273
Target Start/End: Complemental strand, 6525094 - 6524925
Alignment:
104 atattcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagt 203  Q
    ||||| |||| ||||||| | ||||||||| ||  | |||||   |||||||||||| | ||| |||||||| || ||||||| || ||||||||| ||     
6525094 atattaaaacctaccaaaaaggaagtaatcgaggctcttattctgaacaaattcatatacaagtagtctttctcttccttctatacagaaaccaagtagc 6524995  T
204 ctaactaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
    |||||||| |||||||||||||| || || ||||| | ||||||||| |||||||| | |||||||||||    
6524994 ctaactaagtttcgatgttgaagtttagccactaaaactacttcattcttaaattctaaatctccttggc 6524925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 110 - 271
Target Start/End: Original strand, 6511011 - 6511172
Alignment:
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| ||||| |||||||| || |||||||  | |||||| || | ||| |||    
6511011 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcatatataagtagtctttctcttccttctaggcagaaaccgagtaatcttact 6511110  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||| |||||||| || || ||||| ||||||||||| ||||| || | |||||||||    
6511111 aaatttcggtgttgaagtttagccactaaaaatacttcattcttaaactctagatctccttg 6511172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 110 - 226
Target Start/End: Original strand, 6515434 - 6515550
Alignment:
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| || || ||||| |||||||||||||||||||  | |||||| || | |||||||    
6515434 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcgtatataagtagtctttcactcccttctaggcagaaaccgagtaatctaact 6515533  T
210 aaatttcgatgttgaag 226  Q
    |||||||| ||||||||    
6515534 aaatttcggtgttgaag 6515550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 271
Target Start/End: Original strand, 6498063 - 6498233
Alignment:
101 tagatattcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaaga 200  Q
    |||||||| |||| ||||||| ||||| ||||| ||| |||| |||  |||||||||||| | ||| | |||||| || |||||||    |||||| ||     
6498063 tagatattaaaacttaccaaaaatgaaataatcgagacttttgttttgaacaaattcatatacaagtactctttctcttccttctagtgagaaaccgagt 6498162  T
201 agtctaactaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    ||||||||||||||||| ||||||||||| || || || | ||| ||||| ||||| |||  |||||||||    
6498163 agtctaactaaatttcggtgttgaagcttagccaccaaaagtacctcattcttaaactccgaatctccttg 6498233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 115 - 229
Target Start/End: Complemental strand, 47689917 - 47689803
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    ||||||||||||  ||||||||| ||||||| |  ||||| |||||||| || |||||||| ||   || ||||| |||||| || ||| ||||||||||    
47689917 taccaaatatgatataatcaagacttttattggagacaaactcataaattagtagtctttctcttttttgtaaacagaaacctagtagtttaactaaatt 47689818  T
215 tcgatgttgaagctt 229  Q
    |||||||||||||||    
47689817 tcgatgttgaagctt 47689803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 420 - 471
Target Start/End: Complemental strand, 47774387 - 47774336
Alignment:
420 tatcttacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    ||||||||||||||||||||||| || || ||||| ||||||||||||||||    
47774387 tatcttacccgataaacaactccgaacccaccttgtccaagtttattagaat 47774336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 256
Target Start/End: Original strand, 6503391 - 6503537
Alignment:
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| | |||||||||||| || |||||||  |  ||||| || | |||||||    
6503391 aaacctaccaaaaataaagtaatcaagacttttattacaaacaaactcatatacaagaagtctttctcttccttctaggcaaaaaccgagtaatctaact 6503490  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaa 256  Q
    | |||||  |||||||| || || ||||| || |||||||| |||||    
6503491 agatttctgtgttgaagtttagcaactaaaaacacttcattcttaaa 6503537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 423 - 468
Target Start/End: Original strand, 47712167 - 47712212
Alignment:
423 cttacccgataaacaactccaaatccgccttgcccaagtttattag 468  Q
    |||||| |||||||||||||||||||||| || |||||||||||||    
47712167 cttacctgataaacaactccaaatccgccatgtccaagtttattag 47712212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 467
Target Start/End: Original strand, 47744717 - 47744759
Alignment:
425 tacccgataaacaactccaaatccgccttgcccaagtttatta 467  Q
    |||| |||||||||||||||||||||| || ||||||||||||    
47744717 tacctgataaacaactccaaatccgccatgtccaagtttatta 47744759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 109; Significance: 1e-54; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 107 - 307
Target Start/End: Original strand, 27369129 - 27369329
Alignment:
107 ttcaaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtcta 206  Q
    ||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||| |||||||||| || ||||||||| || |||    
27369129 ttcaaacttaccaaatatgaagtaatcaagacttttatttgaaacaaattcataaataagtagtctttctctcccttctagacagaaaccaagtagccta 27369228  T
207 actaaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggctggaatcttttaacaatctttttacagcaatca 306  Q
    |||| ||||||||||||||| ||||||||||| | ||||||||||||||| || ||||||||||||   |||| | || |||| ||||| ||||||||||    
27369229 actagatttcgatgttgaagtttggctactaaaagtacttcatttttaaactcaacatctccttggtcagaatttgttgacaaccttttcacagcaatca 27369328  T
307 t 307  Q
    |    
27369329 t 27369329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 115 - 271
Target Start/End: Original strand, 28829285 - 28829441
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | |||||||||||| | ||| | |||||| |||||||| | | | |||||||| ||||||||||||||    
28829285 taccaaatatgaagtagtcaagacttttattaggaacaaattcatagacaagtaatctttctctcccttcaacagtaaaaccaaggagtctaactaaatt 28829384  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    ||| |||||||| ||||| || ||   |||||| || |||||||| | |||||||||    
28829385 tcggtgttgaagtttggccaccaaacgtacttcgttcttaaattctagatctccttg 28829441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28854962 - 28855120
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | |||||||||||| |  || |||||||| |||||||| | | | |||||||| |  |||||||||||    
28854962 taccaaatatgaagtagtcaagacttttattgggaacaaattcatagactagtagtctttctctcccttcgatagtaaaaccaagtaacctaactaaatt 28855061  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
    | |||||||||| || || |  || | || |||||| |||||||||| |||||||||||    
28855062 ttgatgttgaagtttagccatcaagattaattcattcttaaattccagatctccttggc 28855120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28860321 - 28860479
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||||||||||||||| |||||| ||||||| | || ||||||||| | ||| |||||||| |||||||| | | | |||||||| ||||||||||||||    
28860321 taccaaatatgaagtagtcaagacttttattgggaataaattcatagacaagtagtctttctctcccttcaatagtaaaaccaagtagtctaactaaatt 28860420  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
     || |||||||| ||||| | ||| |  |||||||| ||||| ||   |||||||||||    
28860421 ccggtgttgaagtttggccattaaaagcacttcattcttaaactctctatctccttggc 28860479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 28874891 - 28875049
Alignment:
115 taccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatt 214  Q
    |||| ||||||||||| || ||| ||||||| | || ||||||||| | ||| |||||||| |||||||| | | | |||||||| |||||||| |||||    
28874891 taccgaatatgaagtagtctagacttttattgggaataaattcatagacaagtagtctttctctcccttcaatagtaaaaccaagtagtctaaccaaatt 28874990  T
215 tcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttggc 273  Q
     || |||||||| ||||| | ||| |  |||||||| |||||||| | |||||||||||    
28874991 ccggtgttgaagtttggccattaaaagcacttcattcttaaattctatatctccttggc 28875049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 418 - 472
Target Start/End: Original strand, 27369430 - 27369484
Alignment:
418 ggtatcttacccgataaacaactccaaatccgccttgcccaagtttattagaatt 472  Q
    |||||| |||||||||||||| ||||||||| ||||| |||||||||||||||||    
27369430 ggtatcatacccgataaacaattccaaatccaccttgtccaagtttattagaatt 27369484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 420 - 471
Target Start/End: Original strand, 28829754 - 28829805
Alignment:
420 tatcttacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    ||||| ||| |||||||| |||||||||| ||||||||||||||||||||||    
28829754 tatctcacctgataaacagctccaaatccaccttgcccaagtttattagaat 28829805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 471
Target Start/End: Original strand, 28855459 - 28855505
Alignment:
425 tacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    |||| |||||||| |||||||||||||||  ||||||||||||||||    
28855459 tacctgataaacagctccaaatccgccttcgccaagtttattagaat 28855505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 471
Target Start/End: Original strand, 28860665 - 28860711
Alignment:
425 tacccgataaacaactccaaatccgccttgcccaagtttattagaat 471  Q
    |||| |||| ||| ||||||||||||||| |||||||||||||||||    
28860665 tacctgatatacagctccaaatccgccttccccaagtttattagaat 28860711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 110 - 271
Target Start/End: Original strand, 12692 - 12852
Alignment:
110 aaacgtaccaaatatgaagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaact 209  Q
    |||| ||||||| || |||||||||||| |||||||   |||||| ||||| ||||| |||||||| || |||||||  | |||||| || | ||| |||    
12692 aaacctaccaaaaataaagtaatcaagacttttattatgaacaaactcatatataagtagtctttctcttccttctaggcagaaaccgagtaatcttact 12791  T
210 aaatttcgatgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||| |||||||| || || ||||| ||||||||||| ||||| || | |||||||||    
12792 aaatttcggtgttgaagtttagccactaa-aatacttcattcttaaactctagatctccttg 12852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 256
Target Start/End: Original strand, 5089 - 5219
Alignment:
126 aagtaatcaagatttttatttgtaacaaattcataaataagaagtctttcactcccttctaaactgaaaccaagaagtctaactaaatttcgatgttgaa 225  Q
    |||||||||||| |||||||   |||||| ||||| | |||||||||||| || |||||||  |  ||||| || | |||||||| |||||  |||||||    
5089 aagtaatcaagacttttattacaaacaaactcatatacaagaagtctttctcttccttctaggcaaaaaccgagtaatctaactagatttctgtgttgaa 5188  T
226 gcttggctactaataatacttcatttttaaa 256  Q
    | || || ||||| || |||||||| |||||    
5189 gtttagcaactaaaaacacttcattcttaaa 5219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 219 - 271
Target Start/End: Original strand, 36067460 - 36067512
Alignment:
219 tgttgaagcttggctactaataatacttcatttttaaattccacatctccttg 271  Q
    |||||||||||||||| ||| ||||| ||||| |||||||||||| |||||||    
36067460 tgttgaagcttggctattaacaatacctcattcttaaattccacagctccttg 36067512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC