View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-10 (Length: 771)

Name: F9295-LTR4-TNT-insertion-10
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9295-LTR4-TNT-insertion-10
F9295-LTR4-TNT-insertion-10
[»] chr4 (6 HSPs)
chr4 (10-771)||(36467212-36467973)
chr4 (567-676)||(36496152-36496261)
chr4 (128-184)||(44454526-44454582)
chr4 (117-182)||(21520769-21520833)
chr4 (129-184)||(42403515-42403570)
chr4 (117-182)||(39142447-39142512)
[»] chr7 (3 HSPs)
chr7 (71-182)||(47510326-47510435)
chr7 (152-183)||(34342208-34342239)
chr7 (112-179)||(47819376-47819443)
[»] chr2 (4 HSPs)
chr2 (74-184)||(41811771-41811878)
chr2 (126-182)||(44249337-44249393)
chr2 (128-171)||(42843926-42843969)
chr2 (71-148)||(45099171-45099247)
[»] chr8 (2 HSPs)
chr8 (117-181)||(16971392-16971456)
chr8 (133-178)||(38324851-38324896)
[»] chr3 (3 HSPs)
chr3 (116-184)||(2055472-2055540)
chr3 (73-180)||(47232519-47232630)
chr3 (129-182)||(2504831-2504884)
[»] chr1 (5 HSPs)
chr1 (128-184)||(24588090-24588146)
chr1 (72-150)||(688489-688570)
chr1 (114-184)||(16193530-16193600)
chr1 (75-184)||(28306721-28306830)
chr1 (132-177)||(32670129-32670174)
[»] scaffold0325 (1 HSPs)
scaffold0325 (137-184)||(7963-8010)
[»] chr5 (2 HSPs)
chr5 (120-184)||(18754065-18754129)
chr5 (128-184)||(32708708-32708764)


Alignment Details
Target: chr4 (Bit Score: 758; Significance: 0; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 758; E-Value: 0
Query Start/End: Original strand, 10 - 771
Target Start/End: Original strand, 36467212 - 36467973
Alignment:
10 tagtcagttaccataatgtactagctaaaaactaagcaaagtacatattgaatgtatattcattgaataaaccatcaatttaatctctgaaatatcaacc 109  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467212 tagtcagttaccataatgtactaactaaaaactaagcaaagtacatattgaatgtatattcattgaataaaccatcaatttaatctctgaaatatcaacc 36467311  T
110 tatctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagtaaaattgttatcaagatgttggaga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467312 tatctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagtaaaattgttatcaagatgttggaga 36467411  T
210 cttaattgatggattttcatatattttaagaacaaaattgacatatttcatatacattaagactactaattatatttatataattcgtatattttataga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467412 cttaattgatggattttcatatattttaagaacaaaattgacatatttcatatacattaagactactaattatatttatataattcgtatattttataga 36467511  T
310 ctaaattgatagatttcaaattcattaggactggttatcatattcatatagttcatggaataatttgaagagataatgatatatagtttagggaatttaa 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467512 ctaaattgatagatttcaaattcattaggactggttatcatattcatatagttcatggaataatttgaagagataatgatatatagtttagggaatttaa 36467611  T
410 gtgcttacatttgtgatgattggtactaaagacctaagcaccaaaagtctgctagtgagtttctcccttctctttctttctgtctcaaggttcttggatg 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467612 gtgcttacatttgtgatgattggtactaaagacctaagcaccaaaagtctgctagtgagtttctcccttctctttctttctgtctcaaggttcttggatg 36467711  T
510 tgaacacttttgggacaccatcattatcacggtgcttgttctttctccagtttcccctattgctaccattttcagcattgaaacctaactcttccataga 609  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467712 tgaacacttttgggacaccatcattatcacggtgcttgttctttctccagtttcccctattgctaccattttcagcattgaaacctaactcttccataga 36467811  T
610 cacacatagtctattgttatttacttgttccattttgtgtgttaggaatgaagaaacaagtattgaataaaatttaaatttgggagagaaagtataaact 709  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467812 cacacatagtctattgttatttacttgttccattttgtgtgttaggaatgaagaaacaagtattgaataaaatttaaatttgggagagaaagtataaact 36467911  T
710 aagttttggatgttacaagctaatatataaataaatgcttctcacaaaggcatcatgtgtat 771  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467912 aagttttggatgttacaagctaatatataaataaatgcttctcacaaaggcatcatgtgtat 36467973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 567 - 676
Target Start/End: Original strand, 36496152 - 36496261
Alignment:
567 tattgctaccattttcagcattgaaacctaactcttccatagacacacatagtctattgttatttacttgttccattttgtgtgttaggaatgaagaaac 666  Q
    |||||||  ||||||||||||||||||| || ||||| | ||||| || ||||||  | | || | |||||||||||||| ||||| |||||||||||||    
36496152 tattgctgtcattttcagcattgaaacccaaatcttctagagacaaacttagtctgatatcatgttcttgttccattttgggtgttgggaatgaagaaac 36496251  T
667 aagtattgaa 676  Q
    ||||||||||    
36496252 aagtattgaa 36496261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 128 - 184
Target Start/End: Complemental strand, 44454582 - 44454526
Alignment:
128 taaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    ||||| ||||||||||||||||||||| |||||||||||||||| | ||||||||||    
44454582 taaacaatataaatataataactagtcactaaagtatataaaattcatcaatttagt 44454526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 182
Target Start/End: Complemental strand, 21520833 - 21520769
Alignment:
117 aatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaattta 182  Q
    ||||||||||||||| ||||| |||||||||| || |||||||| ||||| |||| ||||||||||    
21520833 aatttagttcataaattatat-aatataataagtaatccctaaattatatgaaattcgtcaattta 21520769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 184
Target Start/End: Complemental strand, 42403570 - 42403515
Alignment:
129 aaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    |||||| ||||||||||||| || ||||||||||| || ||||| |||||||||||    
42403570 aaactaaataaatataataagtattccctaaagtaaatgaaatctgtcaatttagt 42403515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 182
Target Start/End: Complemental strand, 39142512 - 39142447
Alignment:
117 aatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaattta 182  Q
    |||||||| | |||| | |||||||||||  | |||||||||||| |||| |||||||||||||||    
39142512 aatttagtccctaaaatctataaatataagtagtagtccctaaagcatatgaaatccgtcaattta 39142447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 3e-16; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 71 - 182
Target Start/End: Complemental strand, 47510435 - 47510326
Alignment:
71 attgaataaaccatcaatttaatctctgaaatatcaacctatctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaa 170  Q
    ||||||||||||||| ||||| ||||| || |||||  || ||  ||||||||| |  ||||||||||||||||||||  ||||| |||||||||| |||    
47510435 attgaataaaccatccatttagtctctaaattatcactctctcactaatttagtccccaaactatataaatataataa--agtccataaagtatatgaaa 47510338  T
171 tccgtcaattta 182  Q
    ||||||||||||    
47510337 tccgtcaattta 47510326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 183
Target Start/End: Complemental strand, 34342239 - 34342208
Alignment:
152 gtccctaaagtatataaaatccgtcaatttag 183  Q
    ||||||||||||||||||||||||||||||||    
34342239 gtccctaaagtatataaaatccgtcaatttag 34342208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 179
Target Start/End: Complemental strand, 47819443 - 47819376
Alignment:
112 tctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaat 179  Q
    |||| |||||||| | |||||||| |||||||||||| ||||| |||| ||| ||||||||| |||||    
47819443 tcttcaatttagtccctaaactatgtaaatataataagtagtctctaaggtaaataaaatccatcaat 47819376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 184
Target Start/End: Original strand, 41811771 - 41811878
Alignment:
74 gaataaaccatcaatttaatctctgaaatatcaacctatctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatcc 173  Q
    |||||||||||||||| ||||||| || ||||| ||| | | ||| ||||| | ||||||  |||||||||||   ||||||||||||||||| |||||     
41811771 gaataaaccatcaattcaatctctaaactatcagcctttatctaacttagtccctaaactgcataaatataat---tagtccctaaagtatatgaaatct 41811867  T
174 gtcaatttagt 184  Q
    |||||||||||    
41811868 gtcaatttagt 41811878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 126 - 182
Target Start/End: Complemental strand, 44249393 - 44249337
Alignment:
126 cataaactatataaatataataactagtccctaaagtatataaaatccgtcaattta 182  Q
    |||||||||||||||| |||||| ||||||||||||||  ||| |||| ||||||||    
44249393 cataaactatataaatgtaataagtagtccctaaagtacttaatatccatcaattta 44249337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 171
Target Start/End: Original strand, 42843926 - 42843969
Alignment:
128 taaactatataaatataataactagtccctaaagtatataaaat 171  Q
    |||||||||||||||||||||||||| |  ||||||||||||||    
42843926 taaactatataaatataataactagtgctcaaagtatataaaat 42843969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 148
Target Start/End: Original strand, 45099171 - 45099247
Alignment:
71 attgaataaaccatcaatttaatctctgaaatatcaacctatctttaatttagttcataaactatataaatataataa 148  Q
    |||||||||| |||||||||| ||||| || |||||   | |||||||||||| ||| ||| ||||||||||||||||    
45099171 attgaataaatcatcaatttattctctaaattatcattttctctttaatttag-tcacaaaatatataaatataataa 45099247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 181
Target Start/End: Complemental strand, 16971456 - 16971392
Alignment:
117 aatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaattt 181  Q
    |||||||||| ||||||||  ||||||||||| |||| | ||||||||||| |||||||||||||    
16971456 aatttagttcctaaactatccaaatataataaatagttcgtaaagtatatagaatccgtcaattt 16971392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 38324896 - 38324851
Alignment:
133 tatataaatataataactagtccctaaagtatataaaatccgtcaa 178  Q
    |||||| ||||||||| ||| |||||||||||||||||||| ||||    
38324896 tatatagatataataagtagaccctaaagtatataaaatccttcaa 38324851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.00000000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 2055472 - 2055540
Alignment:
116 taatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    ||||||||| | ||||||||||| | ||||||| |||| |||||||||||| ||||| |||||||||||    
2055472 taatttagtccctaaactatatataaataataagtagttcctaaagtatatgaaatcggtcaatttagt 2055540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 180
Target Start/End: Original strand, 47232519 - 47232630
Alignment:
73 tgaataaaccatcaatttaatctctgaaatatcaacctatcttt----aatttagttcataaactatataaatataataactagtccctaaagtatataa 168  Q
    |||||||| ||||||||||||| ||||| |||| | | |||| |    |||||||| |||||||||| |||||||| ||| ||||||||||| ||||| |    
47232519 tgaataaatcatcaatttaatccctgaattatctatcaatctctcaccaatttagtccataaactatttaaatatattaaatagtccctaaactatatga 47232618  T
169 aatccgtcaatt 180  Q
    ||| | ||||||    
47232619 aattcatcaatt 47232630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 2504884 - 2504831
Alignment:
129 aaactatataaatataataactagtccctaaagtatataaaatccgtcaattta 182  Q
    |||| |||||||||| |||| ||| ||||||| ||||| |||||||||||||||    
2504884 aaacaatataaatatcataaatagcccctaaattatatgaaatccgtcaattta 2504831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 184
Target Start/End: Original strand, 24588090 - 24588146
Alignment:
128 taaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    |||| ||| |||||||||||| |||||||||||||||||||||||| | ||||||||    
24588090 taaattatttaaatataataattagtccctaaagtatataaaatccattaatttagt 24588146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 150
Target Start/End: Original strand, 688489 - 688570
Alignment:
72 ttgaataaaccatcaatttaat---ctctgaaatatcaacctatctttaatttagttcataaactatataaatataataact 150  Q
    |||||||||||||||||||||    |||| || ||||| | |||||| |||||||| ||||||||||||||||  |||||||    
688489 ttgaataaaccatcaatttaacgtactctaaactatcatcatatcttcaatttagtccataaactatataaatcaaataact 688570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 114 - 184
Target Start/End: Complemental strand, 16193600 - 16193530
Alignment:
114 tttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    ||||||||| ||  |||||||| |||||||| ||| ||||||||||| |||||||||| | | ||||||||    
16193600 tttaatttactttctaaactatgtaaatatactaaatagtccctaaaatatataaaatacattaatttagt 16193530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 184
Target Start/End: Original strand, 28306721 - 28306830
Alignment:
75 aataaaccatcaatttaatctctgaaatatcaacctatctttaatttagttcataaactatataaatataataactagtccctaaagtatataaaatccg 174  Q
    ||||||||||||||||| ||||| || ||||    | ||||||| |||||   ||||||||||||||| ||||  | |||| ||| |||||||||||| |    
28306721 aataaaccatcaatttagtctctaaactatctctttttctttaacttagtctctaaactatataaatacaataggtggtccataaggtatataaaatctg 28306820  T
175 tcaatttagt 184  Q
    |||| |||||    
28306821 tcaaattagt 28306830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 177
Target Start/End: Original strand, 32670129 - 32670174
Alignment:
132 ctatataaatataataactagtccctaaagtatataaaatccgtca 177  Q
    ||||||||||||||||| || |||||||||||||| |||| |||||    
32670129 ctatataaatataataagtaatccctaaagtatatgaaattcgtca 32670174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0325
Description:

Target: scaffold0325; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 137 - 184
Target Start/End: Original strand, 7963 - 8010
Alignment:
137 taaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    |||||| ||||| ||||||||||||||||||||||| |||||||||||    
7963 taaataaaataagtagtccctaaagtatataaaatctgtcaatttagt 8010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 18754129 - 18754065
Alignment:
120 ttagttcataaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    |||||| ||||||  | |||||||||||| ||||  |||||||||||||||| ||||||||||||    
18754129 ttagtttataaacattgtaaatataataagtagtttctaaagtatataaaattcgtcaatttagt 18754065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 128 - 184
Target Start/End: Original strand, 32708708 - 32708764
Alignment:
128 taaactatataaatataataactagtccctaaagtatataaaatccgtcaatttagt 184  Q
    ||||||||| ||||||||||||||||| ||| | |||||||||  ||||||||||||    
32708708 taaactatacaaatataataactagtctctacactatataaaaatcgtcaatttagt 32708764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98652 times since January 2019
Visitors: 2275