View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-3 (Length: 619)

Name: F9295-LTR4-TNT-insertion-3
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9295-LTR4-TNT-insertion-3
F9295-LTR4-TNT-insertion-3
[»] chr1 (1 HSPs)
chr1 (9-598)||(13396898-13397487)
[»] chr5 (3 HSPs)
chr5 (329-594)||(19944313-19944578)
chr5 (60-312)||(19943979-19944235)
chr5 (329-521)||(31622651-31622844)
[»] chr6 (4 HSPs)
chr6 (329-594)||(796193-796458)
chr6 (60-312)||(8273035-8273291)
chr6 (329-543)||(8273369-8273583)
chr6 (60-312)||(796536-796792)
[»] chr7 (3 HSPs)
chr7 (329-594)||(6692363-6692628)
chr7 (60-303)||(6692029-6692276)
chr7 (329-411)||(9431363-9431445)
[»] chr8 (2 HSPs)
chr8 (123-193)||(38109807-38109876)
chr8 (268-303)||(38109936-38109971)


Alignment Details
Target: chr1 (Bit Score: 590; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 590; E-Value: 0
Query Start/End: Original strand, 9 - 598
Target Start/End: Complemental strand, 13397487 - 13396898
Alignment:
9 aggattctagcaaaaggaagaattttactatgaaattttgttccaatagttaagctcaatactatcatgtttctattaagtattgttgccattgaaaatc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13397487 aggattctagcaaaaggaagaattttactatgaaattttgttccaatagttaagctcaatactatcatgtttctattaagtattgttgccattgaaaatc 13397388  T
109 tttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttagttgaggatatatacatgcaccaacctgaaggattctcataagaagtggg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13397387 tttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttagttgaggatatatacatgcaccaacctgaaggattctcataagaagtggg 13397288  T
209 gaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaaggtccaagacaatgtatatgaagtttgaaagctttatgcacaaggaagggtttc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13397287 gaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaaggtccaagacaatgtatatgaagtttgaaagctttatgcacaaggaagggtttc 13397188  T
309 agaagtgaaatttcaaccattgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggattta 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13397187 agaagtgaaatttcaaccattgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggattta 13397088  T
409 ggtccagcaaagaaaatcattggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaa 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13397087 ggtccagcaaagaaaatcattggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaa 13396988  T
509 tattcaacatgggcaatgccatacttgttagcacaactttggcaagtcatttttgcctatcccatgaacaatcacctcagacggagaaag 598  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13396987 tattcaacatgggcaatgccatacttgttagcacaactttggcaagtcatttttgcctatcccatgaacaatcacctcagacggagaaag 13396898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 170; Significance: 6e-91; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 329 - 594
Target Start/End: Original strand, 19944313 - 19944578
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggtccagcaaagaaaatcat 428  Q
    |||||||||  ||||||||||||||||||||||||||||| ||||  | ||| ||||||||| ||||||||||||||||||||||||||||||||||| |    
19944313 tgttagtagcaggctcaaacattgatgagatcaaaaacttgaagattcaattgtcaaaagaatttgacatgaaggatttaggtccagcaaagaaaatcct 19944412  T
429 tggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaatattcaacatgggcaatgcc 528  Q
    |||||||||||||| || ||||||||||||||| |||||| ||||||||||||  ||||||||||  ||||||||||||| ||||||||||||| |||||    
19944413 tggtatgcaaatcacgagagataagcaaaaaggtgttttgcagttatctcaagcggagtacatcaaccgtgttttgcaaagattcaacatgggcgatgcc 19944512  T
529 atacttgttagcacaactttggcaagtcatttttgcctatcccatgaacaatcacctcagacggag 594  Q
    | ||| ||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||    
19944513 aaactggttagcacacctttggcaagtcattttcgcctatcccaagaacaatcacctcagacggag 19944578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 60 - 312
Target Start/End: Original strand, 19943979 - 19944235
Alignment:
60 aagctcaatactatcatgtttctattaagtattgttgccattgaaaatctttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttag 159  Q
    |||||||||||||||| || | | |||||||||||||||| ||||||||| ||||||||  |||| |||||||||||||||||||||| |||||||||||    
19943979 aagctcaatactatcaggtctgtcttaagtattgttgccagtgaaaatctctatcttgagcagttagatgtgaagactgcatttcttcatggagacttag 19944078  T
160 ttgaggatatatacatgcaccaacctgaaggattctcataagaagtg---gggaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaagg 256  Q
    | ||||| ||||||||||||||||| |||||||||| | |||||| |   | ||| |||||| | |  |||||||||||| ||||||| ||||||||||     
19944079 tggaggaaatatacatgcaccaacccgaaggattcttagaagaagggaaagagaatatggtgtgcaggctaaagaagagcttgtatggcctaaaacaagc 19944178  T
257 tccaagacaat-gtatatgaagtttgaaagctttatgcacaaggaagggtttcagaa 312  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||| || |||||    
19944179 tccaagacaatggtatatgaagtttgaaagcttcatgcacaaggaaggtttccagaa 19944235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 329 - 521
Target Start/End: Complemental strand, 31622844 - 31622651
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggtccagcaaagaaaatcat 428  Q
    |||||||||| |||||| ||||||| |||||||| ||| | ||||| |  || ||||||||| ||||||||||| | ||| ||||  |||||||||||      
31622844 tgttagtagtaggctcatacattgacgagatcaataacatgaagacacagttgtcaaaagaatttgacatgaagcacttatgtccgacaaagaaaatccg 31622745  T
429 tggtat--gcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaatattcaacatggg 521  Q
    ||||||  ||||||||||  ||||| ||| |||||||||||| |||||||||||| ||||| |||||  | |||||||| || ||||||||||||    
31622744 tggtatatgcaaatcatgtgagataggcataaaggagttttgcagttatctcaagcagagtgcatcaaccatgttttgc-aagattcaacatggg 31622651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 166; Significance: 2e-88; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 329 - 594
Target Start/End: Complemental strand, 796458 - 796193
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggtccagcaaagaaaatcat 428  Q
    |||||||||  ||||||||||||||||||||||||||||| ||||  | ||| ||||||||| ||||||||||||||||||||||||||||||||||| |    
796458 tgttagtagcaggctcaaacattgatgagatcaaaaacttgaagattcaattgtcaaaagaatttgacatgaaggatttaggtccagcaaagaaaatcct 796359  T
429 tggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaatattcaacatgggcaatgcc 528  Q
    |||||||||||||| || ||||||||||||||| |||||| |||||||| |||  ||||||||||  ||||||||||||| ||||||||||||| |||||    
796358 tggtatgcaaatcacgagagataagcaaaaaggtgttttgcagttatcttaagcggagtacatcaaccgtgttttgcaaagattcaacatgggcgatgcc 796259  T
529 atacttgttagcacaactttggcaagtcatttttgcctatcccatgaacaatcacctcagacggag 594  Q
    | ||| ||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||    
796258 aaactggttagcacacctttggcaagtcattttcgcctatcccaagaacaatcacctcagacggag 796193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 60 - 312
Target Start/End: Original strand, 8273035 - 8273291
Alignment:
60 aagctcaatactatcatgtttctattaagtattgttgccattgaaaatctttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttag 159  Q
    |||||||||||||||| || | | |||||||||||||||| ||||||||| ||||||||  |||| |||||||||||||||||||||| |||||||||||    
8273035 aagctcaatactatcaggtctgtcttaagtattgttgccagtgaaaatctctatcttgagcagttagatgtgaagactgcatttcttcatggagacttag 8273134  T
160 ttgaggatatatacatgcaccaacctgaaggattctcataagaagtg---gggaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaagg 256  Q
    | ||||| ||||||||||||||||| |||||||||| | |||||| |   | ||| |||||| | |  |||||||||||| ||||||| ||||||||||     
8273135 tggaggaaatatacatgcaccaacccgaaggattcttagaagaagggaaagagaatatggtgtgcaggctaaagaagagcttgtatggcctaaaacaagc 8273234  T
257 tccaagacaat-gtatatgaagtttgaaagctttatgcacaaggaagggtttcagaa 312  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||| || |||||    
8273235 tccaagacaatggtatatgaagtttgaaagcttcatgcacaaggaaggtttccagaa 8273291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 329 - 543
Target Start/End: Original strand, 8273369 - 8273583
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggtccagcaaagaaaatcat 428  Q
    |||||||||  ||||||||||||||||||||||||||||| ||||  | ||| |||||| || |||| |||||||||||||||||||||||||||||| |    
8273369 tgttagtagcaggctcaaacattgatgagatcaaaaacttgaagattcaattgtcaaaataatttgatatgaaggatttaggtccagcaaagaaaatcct 8273468  T
429 tggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaatattcaacatgggcaatgcc 528  Q
    |||||||||||||| || ||||||||||||||| |||||| ||||||||||||  ||||||||||  ||||||||||||| ||||||||||||| |||||    
8273469 tggtatgcaaatcacgagagataagcaaaaaggtgttttgcagttatctcaagcggagtacatcaaccgtgttttgcaaagattcaacatgggcgatgcc 8273568  T
529 atacttgttagcaca 543  Q
    | ||| |||||||||    
8273569 aaactggttagcaca 8273583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 60 - 312
Target Start/End: Complemental strand, 796792 - 796536
Alignment:
60 aagctcaatactatcatgtttctattaagtattgttgccattgaaaatctttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttag 159  Q
    |||||||||||||||| || | | |||||||||||||||| ||||||||| ||||||||  |||| |||||||||||||||||||||| |||||||||||    
796792 aagctcaatactatcaggtctgtcttaagtattgttgccagtgaaaatctctatcttgagcagttagatgtgaagactgcatttcttcatggagacttag 796693  T
160 ttgaggatatatacatgcaccaacctgaaggattctcataagaagtg---gggaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaagg 256  Q
    | ||||| ||||||||||||||||| |||||||||| | |||||| |   | ||| |||||| | |  |||||||||||| ||||||| ||||||||||     
796692 tggaggaaatatacatgcaccaacccgaaggattcttagaagaagggaaagagaatatggtgtgcatgctaaagaagagcttgtatggcctaaaacaagc 796593  T
257 tccaagacaat-gtatatgaagtttgaaagctttatgcacaaggaagggtttcagaa 312  Q
    ||||||||||| |||||||||||||||||| || |||||||||||||| || |||||    
796592 tccaagacaatggtatatgaagtttgaaagtttcatgcacaaggaaggtttccagaa 796536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 162; Significance: 4e-86; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 4e-86
Query Start/End: Original strand, 329 - 594
Target Start/End: Original strand, 6692363 - 6692628
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggtccagcaaagaaaatcat 428  Q
    |||||||||  |||||| |||||||||||||||||||||| ||||  | ||| ||||||||| ||||||||||||||||||||||||||||||||||| |    
6692363 tgttagtagcaggctcagacattgatgagatcaaaaacttgaagattcaattgtcaaaagaatttgacatgaaggatttaggtccagcaaagaaaatcct 6692462  T
429 tggtatgcaaatcatgatagataagcaaaaaggagttttgtagttatctcaagtagagtacatcactcgtgttttgcaaatattcaacatgggcaatgcc 528  Q
    |||||||||||||| || ||||||||||||||| |||||| ||||||||||||  ||||||||||  ||||||||||||| |||||| |||||| |||||    
6692463 tggtatgcaaatcacgagagataagcaaaaaggtgttttgcagttatctcaagcggagtacatcaaccgtgttttgcaaagattcaatatgggcgatgcc 6692562  T
529 atacttgttagcacaactttggcaagtcatttttgcctatcccatgaacaatcacctcagacggag 594  Q
    | ||| ||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||    
6692563 aaactagttagcacacctttggcaagtcattttcgcctatcccaagaacaatcacctcagacggag 6692628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 60 - 303
Target Start/End: Original strand, 6692029 - 6692276
Alignment:
60 aagctcaatactatcatgtttctattaagtattgttgccattgaaaatctttatcttgaatagttggatgtgaagactgcatttcttcgtggagacttag 159  Q
    |||||||||||||||| || | | |||||||||||||||| ||||||||| ||||||||  |||| |||||||||||||||||||||| |||||||||||    
6692029 aagctcaatactatcaggtctgtcttaagtattgttgccagtgaaaatctctatcttgagcagttagatgtgaagactgcatttcttcatggagacttag 6692128  T
160 ttgaggatatatacatgcaccaacctgaaggattctcataagaagtg---gggaaaatggtgggaaaactaaagaagagcatgtatggactaaaacaagg 256  Q
    | ||||| ||||||||||||||||| |||||||||||| |||||| |   | ||| |||||| | |  |||||||||||| ||||||| ||||||||||     
6692129 tggaggaaatatacatgcaccaacccgaaggattctcagaagaagggaaagagaatatggtgtgcaggctaaagaagagcttgtatggcctaaaacaagc 6692228  T
257 tccaagacaat-gtatatgaagtttgaaagctttatgcacaaggaagg 303  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||    
6692229 tccaagacaatggtatatgaagtttgaaagcttcatgcacaaggaagg 6692276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 329 - 411
Target Start/End: Complemental strand, 9431445 - 9431363
Alignment:
329 tgttagtagttggctcaaacattgatgagatcaaaaacttaaagacgcgattctcaaaagaaattgacatgaaggatttaggt 411  Q
    |||||||||| || || ||||||||| ||||||||||||  ||||| | ||| ||||||||| ||||||||||||| ||||||    
9431445 tgttagtagtaggatccaacattgataagatcaaaaactagaagacacaattgtcaaaagaatttgacatgaaggacttaggt 9431363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 123 - 193
Target Start/End: Original strand, 38109807 - 38109876
Alignment:
123 ttggatgtgaagactgcatttcttcgtggagacttagttgaggatatatacatgcaccaacctgaaggatt 193  Q
    ||||||||||||||||||||||| |  | ||||||||||||||| ||||||||  ||||||||||||||||    
38109807 ttggatgtgaagactgcatttct-cacgaagacttagttgaggagatatacatataccaacctgaaggatt 38109876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 38109936 - 38109971
Alignment:
268 gtatatgaagtttgaaagctttatgcacaaggaagg 303  Q
    ||||||||||||||||||||||||||| ||||||||    
38109936 gtatatgaagtttgaaagctttatgcataaggaagg 38109971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84037 times since January 2019
Visitors: 2323