View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-5 (Length: 680)

Name: F9295-LTR4-TNT-insertion-5
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9295-LTR4-TNT-insertion-5
F9295-LTR4-TNT-insertion-5
[»] chr3 (1 HSPs)
chr3 (11-671)||(42945575-42946235)


Alignment Details
Target: chr3 (Bit Score: 661; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 661; E-Value: 0
Query Start/End: Original strand, 11 - 671
Target Start/End: Complemental strand, 42946235 - 42945575
Alignment:
11 gatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaagg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42946235 gatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaagg 42946136  T
111 agacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatgaaacttctaaaaaccacaaaacacactaag 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42946135 agacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatgaaacttctaaaaaccacaaaacacactaag 42946036  T
211 ccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaacatcacaagcaa 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42946035 ccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaacatcacaagcaa 42945936  T
311 ggtaaaacagtacatcaaaatcattttgaaccttccttgtcatgttttcttcatagtttttgtgcttctataacaaagtggttgagttgagaacttttcc 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42945935 ggtaaaacagtacatcaaaatcattttgaaccttccttgtcatgttttcttcatagtttttgtgcttctataacaaagtggttgagttgagaacttttcc 42945836  T
411 gatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccgcctttt 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42945835 gatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccgcctttt 42945736  T
511 gcttgacgcagattcaacttcaacaactgcatcaggttacatgaataggtcaagggagcctttcacaaccccgggtgattcaaattttgacaccaacatg 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42945735 gcttgacgcagattcaacttcaacaactgcatcaggttacatgaataggtcaagggagcctttcacaaccccgggtgattcaaattttgacaccaacatg 42945636  T
611 gtgtttatcttggcagctttactttgtgcacttatttttgcattaggactcaactcaattg 671  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42945635 gtgtttatcttggcagctttactttgtgcacttatttttgcattaggactcaactcaattg 42945575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77945 times since January 2019
Visitors: 2276