View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-5 (Length: 680)

Name: F9295-LTR4-TNT-insertion-5
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9295-LTR4-TNT-insertion-5
[»] chr3 (1 HSPs)
chr3 (11-671)||(42945575-42946235)

Alignment Details
Target: chr3 (Bit Score: 661; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 661; E-Value: 0
Query Start/End: Original strand, 11 - 671
Target Start/End: Complemental strand, 42946235 - 42945575
11 gatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaagg 110  Q
42946235 gatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaagg 42946136  T
111 agacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatgaaacttctaaaaaccacaaaacacactaag 210  Q
42946135 agacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatgaaacttctaaaaaccacaaaacacactaag 42946036  T
211 ccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaacatcacaagcaa 310  Q
42946035 ccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaacatcacaagcaa 42945936  T
311 ggtaaaacagtacatcaaaatcattttgaaccttccttgtcatgttttcttcatagtttttgtgcttctataacaaagtggttgagttgagaacttttcc 410  Q
42945935 ggtaaaacagtacatcaaaatcattttgaaccttccttgtcatgttttcttcatagtttttgtgcttctataacaaagtggttgagttgagaacttttcc 42945836  T
411 gatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccgcctttt 510  Q
42945835 gatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccgcctttt 42945736  T
511 gcttgacgcagattcaacttcaacaactgcatcaggttacatgaataggtcaagggagcctttcacaaccccgggtgattcaaattttgacaccaacatg 610  Q
42945735 gcttgacgcagattcaacttcaacaactgcatcaggttacatgaataggtcaagggagcctttcacaaccccgggtgattcaaattttgacaccaacatg 42945636  T
611 gtgtttatcttggcagctttactttgtgcacttatttttgcattaggactcaactcaattg 671  Q
42945635 gtgtttatcttggcagctttactttgtgcacttatttttgcattaggactcaactcaattg 42945575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC