View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-6 (Length: 773)

Name: F9295-LTR4-TNT-insertion-6
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9295-LTR4-TNT-insertion-6
F9295-LTR4-TNT-insertion-6
[»] chr5 (1 HSPs)
chr5 (12-763)||(40142148-40142898)


Alignment Details
Target: chr5 (Bit Score: 744; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 744; E-Value: 0
Query Start/End: Original strand, 12 - 763
Target Start/End: Original strand, 40142148 - 40142898
Alignment:
12 gaacaatatgtggggagtattcatcaataagaacaatggaagtacctcttcagctgatgtctgcctcataaaataaccaaaggaagcagatgattggcgt 111  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142148 gaacaatat-tggggagtattcatcaataagaacaatggaagtacctcttcagctgatgtctgcctcataaaataaccaaaggaagcagatgattggcgt 40142246  T
112 gcgaaatataccttattgtcacatctcctaagcacagagttcagactaccactgcaattctgatagggggaggaaaattgattgatgaacaaaacaattt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142247 gcgaaatataccttattgtcacatctcctaagcacagagttcagactaccactgcaattctgatagggggaggaaaattgattgatgaacaaaacaattt 40142346  T
212 ggaaacagattcatgaaaaataggataacaattggttttggtccctggtttctaataggataattattgctttaggtccttggtttctgaaaaggatcaa 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142347 ggaaacagattcatgaaaaataggataacaattggttttggtccctggtttctaataggataattattgctttaggtccttggtttctgaaaaggatcaa 40142446  T
312 attggtttgtctccatactcttgatctctggtttagtcaatttttatttctctcttgtctgattaagagggaccaattatgatcattttgaaaaaagcaa 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142447 attggtttgtctccatactcttgatctctggtttagtcaatttttatttctctcttgtctgattaagagggaccaattatgatcattttgaaaaaagcaa 40142546  T
412 caaaactttttcgagatacaaagtgcatgtttgaattgatggagtgtttggcaaaccatgattttgcaaaaacgacactttgaaacatcaaccaagtcac 511  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142547 caaaactttttcgagatacaaagtgcatgtttgaattgatggagtgtttggcaaaccatgattttgcaaaaacgacactttgaaacatcaaccaagtcac 40142646  T
512 catgattttgtcaaatccaccgtgatttcaaacatgcagaagaacgatatttatcttgcttgatgacctcaaaacatgtttaagccttattttattgaac 611  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142647 catgattttgtcaaatccaccgtgatttcaaacatgcagaagaacgatatttatcttgcttgatgacctcaaaacatgtttaagccttattttattgaac 40142746  T
612 attattatgaaacaagaaagaaaattagtggtataataagagaatagtagtaatttctatgtgctaataatagcaagtacagaatatggaaattctgaat 711  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142747 attattatgaaacaagaaagaaaattagtggtataataagagaatagtagtaatttctatgtgctaataatagcaagtacagaatatggaaattctgaat 40142846  T
712 tagggtctcaactgaaacaattaaattcccaatcttgaacttagggtcatta 763  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142847 tagggtctcaactgaaacaattaaattcccaatcttgaacttagggtcatta 40142898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98592 times since January 2019
Visitors: 2275