View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-6 (Length: 773)

Name: F9295-LTR4-TNT-insertion-6
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9295-LTR4-TNT-insertion-6
[»] chr5 (1 HSPs)
chr5 (12-763)||(40142148-40142898)

Alignment Details
Target: chr5 (Bit Score: 744; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 744; E-Value: 0
Query Start/End: Original strand, 12 - 763
Target Start/End: Original strand, 40142148 - 40142898
12 gaacaatatgtggggagtattcatcaataagaacaatggaagtacctcttcagctgatgtctgcctcataaaataaccaaaggaagcagatgattggcgt 111  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40142148 gaacaatat-tggggagtattcatcaataagaacaatggaagtacctcttcagctgatgtctgcctcataaaataaccaaaggaagcagatgattggcgt 40142246  T
112 gcgaaatataccttattgtcacatctcctaagcacagagttcagactaccactgcaattctgatagggggaggaaaattgattgatgaacaaaacaattt 211  Q
40142247 gcgaaatataccttattgtcacatctcctaagcacagagttcagactaccactgcaattctgatagggggaggaaaattgattgatgaacaaaacaattt 40142346  T
212 ggaaacagattcatgaaaaataggataacaattggttttggtccctggtttctaataggataattattgctttaggtccttggtttctgaaaaggatcaa 311  Q
40142347 ggaaacagattcatgaaaaataggataacaattggttttggtccctggtttctaataggataattattgctttaggtccttggtttctgaaaaggatcaa 40142446  T
312 attggtttgtctccatactcttgatctctggtttagtcaatttttatttctctcttgtctgattaagagggaccaattatgatcattttgaaaaaagcaa 411  Q
40142447 attggtttgtctccatactcttgatctctggtttagtcaatttttatttctctcttgtctgattaagagggaccaattatgatcattttgaaaaaagcaa 40142546  T
412 caaaactttttcgagatacaaagtgcatgtttgaattgatggagtgtttggcaaaccatgattttgcaaaaacgacactttgaaacatcaaccaagtcac 511  Q
40142547 caaaactttttcgagatacaaagtgcatgtttgaattgatggagtgtttggcaaaccatgattttgcaaaaacgacactttgaaacatcaaccaagtcac 40142646  T
512 catgattttgtcaaatccaccgtgatttcaaacatgcagaagaacgatatttatcttgcttgatgacctcaaaacatgtttaagccttattttattgaac 611  Q
40142647 catgattttgtcaaatccaccgtgatttcaaacatgcagaagaacgatatttatcttgcttgatgacctcaaaacatgtttaagccttattttattgaac 40142746  T
612 attattatgaaacaagaaagaaaattagtggtataataagagaatagtagtaatttctatgtgctaataatagcaagtacagaatatggaaattctgaat 711  Q
40142747 attattatgaaacaagaaagaaaattagtggtataataagagaatagtagtaatttctatgtgctaataatagcaagtacagaatatggaaattctgaat 40142846  T
712 tagggtctcaactgaaacaattaaattcccaatcttgaacttagggtcatta 763  Q
40142847 tagggtctcaactgaaacaattaaattcccaatcttgaacttagggtcatta 40142898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC