View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-7 (Length: 227)

Name: F9295-LTR4-TNT-insertion-7
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9295-LTR4-TNT-insertion-7
[»] chr5 (4 HSPs)
chr5 (8-218)||(38153849-38154059)
chr5 (20-189)||(38159940-38160109)
chr5 (20-76)||(38223330-38223386)
chr5 (20-76)||(38229742-38229798)

Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr5

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 38154059 - 38153849
8 gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc 107  Q
38154059 gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc 38153960  T
108 aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt 207  Q
38153959 aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt 38153860  T
208 ttctttgaatt 218  Q
38153859 ttctttgaatt 38153849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 38160109 - 38159940
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagcaaagatggatcc 119  Q
    ||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||    
38160109 aacaaaaaaatgttgttgatgatgattatgacggctatgatttggaacatggcaaaagctgaggagcattttgttggagggggaaggcaaggatggaacc 38160010  T
120 ctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttc 189  Q
    || ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||    
38160009 ctagtaataacttgacaaaatggtccttgaatgagcactttcatgtgaatgattggctatgtaagttttc 38159940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38223386 - 38223330
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa 76  Q
    |||||||  |||||||| | ||||||||||| |||||||||||||| ||||||||||    
38223386 aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa 38223330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38229798 - 38229742
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa 76  Q
    |||||||  |||||||| | ||||||||||| |||||||||||||| ||||||||||    
38229798 aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa 38229742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC