View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9295-LTR4-TNT-insertion-7 (Length: 227)

Name: F9295-LTR4-TNT-insertion-7
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9295-LTR4-TNT-insertion-7
F9295-LTR4-TNT-insertion-7
[»] chr5 (4 HSPs)
chr5 (8-218)||(38153849-38154059)
chr5 (20-189)||(38159940-38160109)
chr5 (20-76)||(38223330-38223386)
chr5 (20-76)||(38229742-38229798)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 38154059 - 38153849
Alignment:
8 gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38154059 gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc 38153960  T
108 aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38153959 aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt 38153860  T
208 ttctttgaatt 218  Q
    |||||||||||    
38153859 ttctttgaatt 38153849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 38160109 - 38159940
Alignment:
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagcaaagatggatcc 119  Q
    ||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||    
38160109 aacaaaaaaatgttgttgatgatgattatgacggctatgatttggaacatggcaaaagctgaggagcattttgttggagggggaaggcaaggatggaacc 38160010  T
120 ctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttc 189  Q
    || ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||    
38160009 ctagtaataacttgacaaaatggtccttgaatgagcactttcatgtgaatgattggctatgtaagttttc 38159940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38223386 - 38223330
Alignment:
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa 76  Q
    |||||||  |||||||| | ||||||||||| |||||||||||||| ||||||||||    
38223386 aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa 38223330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38229798 - 38229742
Alignment:
20 aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa 76  Q
    |||||||  |||||||| | ||||||||||| |||||||||||||| ||||||||||    
38229798 aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa 38229742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93601 times since January 2019
Visitors: 2365