View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-1 (Length: 491)

Name: F9296-LTR4-TNT-insertion-1
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-1
F9296-LTR4-TNT-insertion-1
[»] chr6 (5 HSPs)
chr6 (13-484)||(15052199-15052670)
chr6 (101-220)||(16477086-16477205)
chr6 (131-226)||(18860019-18860114)
chr6 (101-160)||(16476716-16476775)
chr6 (149-190)||(4903289-4903330)
[»] chr4 (32 HSPs)
chr4 (101-226)||(12174785-12174910)
chr4 (100-223)||(12188949-12189072)
chr4 (101-226)||(12172769-12172894)
chr4 (101-226)||(12174119-12174244)
chr4 (101-226)||(12177334-12177459)
chr4 (101-226)||(12182051-12182176)
chr4 (101-226)||(12189289-12189414)
chr4 (108-226)||(12173437-12173555)
chr4 (101-226)||(12175128-12175252)
chr4 (101-226)||(12180477-12180602)
chr4 (101-225)||(12180816-12180940)
chr4 (101-224)||(12170063-12170186)
chr4 (101-226)||(12183954-12184079)
chr4 (101-226)||(12184960-12185085)
chr4 (101-226)||(12185304-12185429)
chr4 (101-226)||(12186609-12186734)
chr4 (101-226)||(12186952-12187077)
chr4 (101-226)||(12188603-12188728)
chr4 (101-226)||(12173778-12173903)
chr4 (101-222)||(12182722-12182843)
chr4 (101-226)||(12187296-12187421)
chr4 (101-225)||(12179239-12179363)
chr4 (101-226)||(12178571-12178696)
chr4 (101-186)||(12186305-12186390)
chr4 (101-186)||(12188299-12188384)
chr4 (104-165)||(52268734-52268795)
chr4 (104-155)||(4375043-4375094)
chr4 (101-224)||(12169474-12169597)
chr4 (101-155)||(12170426-12170480)
chr4 (103-221)||(12184623-12184741)
chr4 (192-226)||(19156132-19156166)
chr4 (136-216)||(1734605-1734684)
[»] chr2 (51 HSPs)
chr2 (101-220)||(24631111-24631230)
chr2 (101-220)||(24621693-24621812)
chr2 (101-220)||(24622012-24622131)
chr2 (101-220)||(24622331-24622450)
chr2 (101-220)||(24622615-24622734)
chr2 (101-220)||(24622899-24623018)
chr2 (101-220)||(24623502-24623621)
chr2 (101-220)||(24623821-24623940)
chr2 (101-220)||(24624414-24624533)
chr2 (101-220)||(24624733-24624852)
chr2 (101-220)||(24625336-24625455)
chr2 (101-220)||(24626909-24627028)
chr2 (101-220)||(24631395-24631514)
chr2 (101-220)||(24631998-24632117)
chr2 (101-220)||(24632282-24632401)
chr2 (101-220)||(24632601-24632720)
chr2 (101-220)||(24632885-24633004)
chr2 (101-220)||(24633169-24633288)
chr2 (101-220)||(24633488-24633607)
chr2 (101-220)||(24633807-24633926)
chr2 (101-220)||(24634091-24634210)
chr2 (101-220)||(24634694-24634813)
chr2 (101-220)||(24638773-24638892)
chr2 (101-220)||(24639092-24639211)
chr2 (103-220)||(24625017-24625134)
chr2 (101-220)||(24623218-24623337)
chr2 (101-220)||(24627228-24627347)
chr2 (101-220)||(24627512-24627631)
chr2 (101-220)||(24631714-24631833)
chr2 (101-220)||(24625978-24626097)
chr2 (101-220)||(24634410-24634529)
chr2 (101-220)||(24638454-24638573)
chr2 (101-220)||(3348060-3348179)
chr2 (101-220)||(24621082-24621205)
chr2 (101-220)||(24635565-24635688)
chr2 (101-220)||(24636266-24636389)
chr2 (101-220)||(24636589-24636712)
chr2 (101-220)||(24639441-24639564)
chr2 (101-220)||(24640087-24640210)
chr2 (101-220)||(24620760-24620882)
chr2 (101-189)||(24636947-24637035)
chr2 (101-220)||(24625655-24625778)
chr2 (101-220)||(24635242-24635365)
chr2 (101-220)||(24621405-24621528)
chr2 (101-220)||(24626298-24626421)
chr2 (101-220)||(24626621-24626744)
chr2 (101-191)||(24630856-24630946)
chr2 (101-220)||(24637514-24637637)
chr2 (101-220)||(24639764-24639887)
chr2 (101-165)||(24637896-24637960)
chr2 (121-167)||(38802359-38802405)
[»] chr5 (3 HSPs)
chr5 (101-220)||(21825705-21825824)
chr5 (100-221)||(25904730-25904851)
chr5 (99-165)||(3153539-3153605)
[»] scaffold1024 (1 HSPs)
scaffold1024 (109-220)||(1-112)
[»] chr3 (2 HSPs)
chr3 (99-218)||(3732644-3732763)
chr3 (102-165)||(16990034-16990097)
[»] chr7 (3 HSPs)
chr7 (127-166)||(8861098-8861137)
chr7 (102-165)||(44836703-44836766)
chr7 (99-151)||(44174763-44174815)
[»] chr1 (1 HSPs)
chr1 (135-216)||(2557869-2557949)
[»] scaffold0050 (1 HSPs)
scaffold0050 (132-220)||(65196-65284)


Alignment Details
Target: chr6 (Bit Score: 451; Significance: 0; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 451; E-Value: 0
Query Start/End: Original strand, 13 - 484
Target Start/End: Original strand, 15052199 - 15052670
Alignment:
13 gggcacatgtgttttaagatttggatcatacatcaactaaaatttaaattaagattttgcaaatcaataatgatatatgtacatacttaggtgcgatcat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15052199 gggcacatgtgttttaagatttggatcatacatcaactaaaatttaaattaagattttgcaaatcaataatgatatatgtacatacttaggtgcgatcat 15052298  T
113 accagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgtt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15052299 accagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgtt 15052398  T
213 gcacctctcccacctccctcataaaaaagatatatgtacatgcttaattttcatatgcttattcaacacttcagtttctttttatttcacttctcatcat 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15052399 gcacctctcccacctccctcataaaaaagatatatgtacatgcttaattttcatatgcttattcaacacttcagtttctttttatttcacttctcatcat 15052498  T
313 attattaacatattacttctatcatatcatcgtcattttattctctctaaggtgtagaatagatatagatgtttatgaaacatttcctttgcaaattaag 412  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15052499 attattaacatattacttctatcatatcatcgtcattttattctctctaaggtgtagaatagatatagatgtttatgaaacatttcctttgcaaattaag 15052598  T
413 caaactaaaaaatctataataagactaatttaannnnnnnaaattatttactacccaatctcatatcaattg 484  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
15052599 caaactaaaaaatctataataagactaatttaatttttttaaattatttactacccaatctcatatcaattg 15052670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 16477205 - 16477086
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||||||||| || |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
16477205 aggtgcgatcataccagcactaatgcaccggatcccatcagaactctgcagtcaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 16477106  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
16477105 agtccttgtgttgcacctct 16477086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 131 - 226
Target Start/End: Original strand, 18860019 - 18860114
Alignment:
131 gatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgttgcacctctcccacc 226  Q
    ||||||||||||||||||||||||| |||| |||| ||| | | ||||||| |||| ||| ||| ||  |||| ||||||||||||||||||||||    
18860019 gatcccatcagaactctgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggaaagtccttgtgttgcacctctcccacc 18860114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 16476775 - 16476716
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtg 160  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| ||||    
16476775 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtg 16476716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 4903289 - 4903330
Alignment:
149 cagttaaacgtgtttggacgaaaatggtactagaatggatga 190  Q
    ||||||||||||||||||||||||| ||| || |||||||||    
4903289 cagttaaacgtgtttggacgaaaatagtattaaaatggatga 4903330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 32)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12174910 - 12174785
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||||||| || |     
12174910 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgatctcctgggt 12174811  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||| ||||||||||||    
12174810 agtccttgtgttgaacctctcccacc 12174785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 100 - 223
Target Start/End: Complemental strand, 12189072 - 12188949
Alignment:
100 taggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgag 199  Q
    |||||||||||||||||||| |||| || | |||||||||||||||| ||||||||  ||| |||| ||| | | || |||| |||| ||| ||| || |    
12189072 taggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaattgtgcttgggcgagagtagttctaggatgggtgacctcctggg 12188973  T
200 aagttcttgtgttgcacctctccc 223  Q
    ||||||||||||||||||||||||    
12188972 aagttcttgtgttgcacctctccc 12188949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12172894 - 12172769
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||| ||| || |     
12172894 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgacctcctgggt 12172795  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||| ||| ||||||||||||    
12172794 agtccttgtattgaacctctcccacc 12172769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12174244 - 12174119
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||| ||| ||  |    
12174244 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgacctcctggaa 12174145  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12174144 agtccttgtgtttaacctctcccacc 12174119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12177459 - 12177334
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| | | || ||    
12177459 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgaccacctggga 12177360  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||| ||||||||||||||||    
12177359 agtccttgtattgcacctctcccacc 12177334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12182176 - 12182051
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||| ||||| |||| || | ||||||||||||||||||||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
12182176 aggtgcgatcatatcagcactaatgcaccggatcccatcagaactctgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 12182077  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12182076 agtccttgtgtttaacctctcccacc 12182051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12189414 - 12189289
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||| |||||||||| || |||| || | |||||||||||||||| ||||||||  ||| |||| ||| | | ||||||| |||||||| ||| || ||    
12189414 aggtgtgatcataccatcactaatgcaccggatcccatcagaactccgcagttaattgtgcttgggcgagagtagtactaggatggatgacctcctggga 12189315  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||||||||||||||||    
12189314 agtccttgtgttgcacctctcccacc 12189289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 108 - 226
Target Start/End: Complemental strand, 12173555 - 12173437
Alignment:
108 atcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttctt 207  Q
    |||||||||||| |||| || | |||||||||||||| | |||||||| ||||||||| ||| | | ||||||| |||||||||||| || | ||| |||    
12173555 atcataccagcactaatgcaccggatcccatcagaacgccgcagttaagcgtgtttgggcgagagtagtactaggatggatgatctcctgggtagtcctt 12173456  T
208 gtgttgcacctctcccacc 226  Q
    ||| || ||||||||||||    
12173455 gtgctgaacctctcccacc 12173437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12175252 - 12175128
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||  | | ||||||| |||||||| ||| || ||    
12175252 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgggagtagtactaggatggatga-ctcctggga 12175154  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12175153 agtccttgtgtttaacctctcccacc 12175128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12180602 - 12180477
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||| ||||| |||| || | |||||||| |||||||||||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
12180602 aggtgcgatcatatcagcactaatgcaccggatcccattagaactctgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 12180503  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12180502 agtccttgtgtttaacctctcccacc 12180477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 101 - 225
Target Start/End: Complemental strand, 12180940 - 12180816
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    |||||| |||||||||||| |||| |||| |||||||| ||||||| |||||||| |||  |||| ||| | | ||||||| |||| ||| ||| ||  |    
12180940 aggtgcaatcataccagcactaatgcatcggatcccattagaactccgcagttaagcgttcttgggcgagagtagtactaggatgggtgacctcctggaa 12180841  T
201 agttcttgtgttgcacctctcccac 225  Q
    ||| |||||||||||||||||||||    
12180840 agtccttgtgttgcacctctcccac 12180816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 101 - 224
Target Start/End: Complemental strand, 12170186 - 12170063
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||| ||||||||||| | || || | ||||||||||||||||||||||||| |||| | || ||| | | ||||||  |||| ||| ||| || ||    
12170186 aggtgcgttcataccagcactgatgcaccggatcccatcagaactctgcagttaagcgtgctagggcgagagtagtactatgatgggtgacctcttggga 12170087  T
201 agttcttgtgttgcacctctccca 224  Q
    ||| ||||||||||||||||||||    
12170086 agtccttgtgttgcacctctccca 12170063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12184079 - 12183954
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||| ||||| |||| || | |||||||||||||||| |||||||  |||| |||||||| | | ||||||| |||| ||| ||| |  ||    
12184079 aggtgcgatcatatcagcactaatgcaccggatcccatcagaactccgcagttacgcgtgcttggacgagagtagtactaggatgggtgacctccttgga 12183980  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12183979 agtccttgtgtttaacctctcccacc 12183954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12185085 - 12184960
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| ||| |||| |||| |||| ||| | | ||||||| |||| ||  ||| || ||    
12185085 aggtgcgatcataccagcactaatgcaccggatcccatcagaactcagcaattaagcgtgcttgggcgagagtagtactaggatgggtggcctcctggga 12184986  T
201 agttcttgtgttgcacctctcccacc 226  Q
     || ||| ||||||||||||||||||    
12184985 ggtccttttgttgcacctctcccacc 12184960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12185429 - 12185304
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| ||| |||| |||| |||| ||| | | |||| || |||| ||  ||| |  ||    
12185429 aggtgcgatcataccagcactaatgcaccggatcccatcagaactcagcaattaagcgtgcttgggcgagagtagtacaaggatgggtgtcctcctagga 12185330  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||||||||||||||||    
12185329 agtccttgtgttgcacctctcccacc 12185304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12186734 - 12186609
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||| ||||||||||||| |||| || | ||| |||||||||||| ||| |||| |||| |||| ||| | | |||| || |||| ||  ||| |||||    
12186734 aggtgtgatcataccagcactaatgcaccggattccatcagaactcagcaattaaccgtgcttgggcgagagtagtacgaggatgggtgtcctcctgaga 12186635  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||||||||||||||||    
12186634 agtccttgtgttgcacctctcccacc 12186609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12187077 - 12186952
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| ||| |||| |||| |||| ||| | | ||||||| |||| ||  ||| || ||    
12187077 aggtgcgatcataccagcactaatgcaccggatcccatcagaactcagcaattaagcgtgcttgggcgagagtagtactaggatgggtggcctcctggga 12186978  T
201 agttcttgtgttgcacctctcccacc 226  Q
     || ||| ||||||||||||||||||    
12186977 ggtccttttgttgcacctctcccacc 12186952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12188728 - 12188603
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||| ||||||||||||| |||| || | ||| |||||||||||| ||| |||| |||| |||| ||| | | |||| || |||| ||  ||| |||||    
12188728 aggtgtgatcataccagcactaatgcaccggattccatcagaactcagcaattaaccgtgcttgggcgagagtagtacgaggatgggtgtcctcctgaga 12188629  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||||||||||||||||    
12188628 agtccttgtgttgcacctctcccacc 12188603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12173903 - 12173778
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    |||||||||||||| |||| |||| || |||||||||||| |||||  ||||||| |||| |||| ||  | | ||||||| |||||||| ||| ||  |    
12173903 aggtgcgatcatactagcactaatgcaccagatcccatcaaaactccacagttaagcgtgcttgggcgggagtagtactaggatggatgacctcctggaa 12173804  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12173803 agtccttgtgtttaacctctcccacc 12173778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 101 - 222
Target Start/End: Complemental strand, 12182843 - 12182722
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||| ||||| |||| || | |||||||| ||||||| |||||||| |||  |||| ||| | | ||||| | |||||||| ||| || ||    
12182843 aggtgcgatcatatcagcactaatgcaccggatcccattagaactccgcagttaagcgttcttgggcgagagtagtacttggatggatgacctcctggga 12182744  T
201 agttcttgtgttgcacctctcc 222  Q
    ||| ||||||||| ||||||||    
12182743 agtccttgtgttgaacctctcc 12182722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12187421 - 12187296
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | || ||||||||||||| ||| |||| |||| |||| ||| | | |||| || |||| ||  ||| |  ||    
12187421 aggtgcgatcataccagcactaatgcaccggagcccatcagaactcagcaattaagcgtgcttgggcgagagtagtacaaggatgggtgtcctcctagga 12187322  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||||||||||||||||    
12187321 agtccttgtgttgcacctctcccacc 12187296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 225
Target Start/End: Complemental strand, 12179363 - 12179239
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    |||||||||||||||| || |||| || | |||||||| ||||||| |||||||| |||  |||| ||| | | |||||   |||||||| ||| || ||    
12179363 aggtgcgatcataccaacactaatgcaccggatcccattagaactccgcagttaagcgttcttgggcgagagtagtactttgatggatgacctcctggga 12179264  T
201 agttcttgtgttgcacctctcccac 225  Q
    ||| ||||||||| |||||||||||    
12179263 agtccttgtgttgaacctctcccac 12179239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 12178696 - 12178571
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    |||||||| |||| ||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||  |||| ||  ||| || ||    
12178696 aggtgcgaccatatcagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactatgatgggtgtcctcctggga 12178597  T
201 agttcttgtgttgcacctctcccacc 226  Q
    ||| ||||||||  ||||||||||||    
12178596 agtccttgtgtttaacctctcccacc 12178571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 101 - 186
Target Start/End: Complemental strand, 12186390 - 12186305
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatgg 186  Q
    ||||||||||||| ||||| |||| || |||||||||||||||||| ||| |||| |||| |||| ||| | | ||||||| ||||    
12186390 aggtgcgatcatatcagcactaatgcaccagatcccatcagaactcagcaattaagcgtgcttgggcgagagtagtactaggatgg 12186305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 101 - 186
Target Start/End: Complemental strand, 12188384 - 12188299
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatgg 186  Q
    ||||||||||||| ||||| |||| || |||||||||||||||||| ||| |||| |||| |||| ||| | | ||||||| ||||    
12188384 aggtgcgatcatatcagcactaatgcaccagatcccatcagaactcagcaattaagcgtgcttgggcgagagtagtactaggatgg 12188299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 104 - 165
Target Start/End: Complemental strand, 52268795 - 52268734
Alignment:
104 tgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttgg 165  Q
    |||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| ||||    
52268795 tgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgg 52268734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 4375094 - 4375043
Alignment:
104 tgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaa 155  Q
    |||||||||||||||| |||| |||| |||  ||||||||||||||||||||    
4375094 tgcgatcataccagcactaatgcatcggatatcatcagaactctgcagttaa 4375043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 224
Target Start/End: Complemental strand, 12169597 - 12169474
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||| |||| |||||||| |||| || |||||  ||||||||||| | |||||| |||| |||| ||| | | || |||| |||| ||| ||  || ||    
12169597 aggtgtgatcgtaccagcactaatgcaccagatttcatcagaactccgtagttaagcgtgcttgggcgagagtagttctaggatgggtgaccttttggga 12169498  T
201 agttcttgtgttgcacctctccca 224  Q
    ||| ||||||||||||||||||||    
12169497 agtccttgtgttgcacctctccca 12169474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 101 - 155
Target Start/End: Complemental strand, 12170480 - 12170426
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaa 155  Q
    ||||||| ||||||||||| | || || |||||||||||||||||| ||||||||    
12170480 aggtgcgttcataccagcactgatgcaccagatcccatcagaactccgcagttaa 12170426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 103 - 221
Target Start/End: Complemental strand, 12184741 - 12184623
Alignment:
103 gtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaag 202  Q
    |||||||||||| || | |||| || | ||||| |||||||||| |||||||| |||| |||| ||| | | |||| || |||| ||| ||| ||  |||    
12184741 gtgcgatcatacaagtactaatgcaccggatccaatcagaactccgcagttaagcgtgcttgggcgagagtagtaccaggatgggtgacctcctggaaag 12184642  T
203 ttcttgtgttgcacctctc 221  Q
    | |||||||||||||||||    
12184641 tccttgtgttgcacctctc 12184623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 192 - 226
Target Start/End: Complemental strand, 19156166 - 19156132
Alignment:
192 ctcatgagaagttcttgtgttgcacctctcccacc 226  Q
    |||||||||||| ||||||||||||||||||||||    
19156166 ctcatgagaagtccttgtgttgcacctctcccacc 19156132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 136 - 216
Target Start/End: Original strand, 1734605 - 1734684
Alignment:
136 catcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgttgcac 216  Q
    |||||||||||  ||||||||| |||| |||||||| | ||||| |||||||||||||  ||||||||  |||| ||||||    
1734605 catcagaactccacagttaaacttgtt-ggacgaaagtagtacttgaatggatgatcttctgagaagtctttgtattgcac 1734684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 51)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24631230 - 24631111
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24631230 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcntggga 24631131  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24631130 agtccttgtgttgcacctct 24631111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24621812 - 24621693
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24621812 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24621713  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24621712 agtccttgtgttgcacctct 24621693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24622131 - 24622012
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24622131 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24622032  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24622031 agtccttgtgttgcacctct 24622012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24622450 - 24622331
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24622450 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24622351  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24622350 agtccttgtgttgcacctct 24622331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24622734 - 24622615
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24622734 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24622635  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24622634 agtccttgtgttgcacctct 24622615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24623018 - 24622899
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24623018 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24622919  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24622918 agtccttgtgttgcacctct 24622899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24623621 - 24623502
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24623621 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24623522  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24623521 agtccttgtgttgcacctct 24623502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24623940 - 24623821
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24623940 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24623841  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24623840 agtccttgtgttgcacctct 24623821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24624533 - 24624414
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24624533 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24624434  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24624433 agtccttgtgttgcacctct 24624414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24624852 - 24624733
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24624852 aggtgcgatcataccagcactaatgcagcggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24624753  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24624752 agtccttgtgttgcacctct 24624733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24625455 - 24625336
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24625455 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24625356  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24625355 agtccttgtgttgcacctct 24625336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24627028 - 24626909
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24627028 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24626929  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24626928 agtccttgtgttgcacctct 24626909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24631514 - 24631395
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24631514 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24631415  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24631414 agtccttgtgttgcacctct 24631395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24632117 - 24631998
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24632117 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24632018  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24632017 agtccttgtgttgcacctct 24631998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24632401 - 24632282
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24632401 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24632302  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24632301 agtccttgtgttgcacctct 24632282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24632720 - 24632601
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24632720 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24632621  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24632620 agtccttgtgttgcacctct 24632601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24633004 - 24632885
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24633004 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24632905  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24632904 agtccttgtgttgcacctct 24632885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24633288 - 24633169
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24633288 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24633189  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24633188 agtccttgtgttgcacctct 24633169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24633607 - 24633488
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24633607 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24633508  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24633507 agtccttgtgttgcacctct 24633488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24633926 - 24633807
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24633926 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24633827  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24633826 agtccttgtgttgcacctct 24633807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24634210 - 24634091
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24634210 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24634111  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24634110 agtccttgtgttgcacctct 24634091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24634813 - 24634694
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24634813 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24634714  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24634713 agtccttgtgttgcacctct 24634694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24638892 - 24638773
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24638892 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24638793  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24638792 agtccttgtgttgcacctct 24638773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24639211 - 24639092
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24639211 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24639112  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24639111 agtccttgtgttgcacctct 24639092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 24625134 - 24625017
Alignment:
103 gtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaag 202  Q
    ||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||||    
24625134 gtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctgggaag 24625035  T
203 ttcttgtgttgcacctct 220  Q
    | ||||||||||||||||    
24625034 tccttgtgttgcacctct 24625017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24623337 - 24623218
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | || |||| |||| ||| ||| || ||    
24623337 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtnctaggatgggtgacctcctggga 24623238  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24623237 agtccttgtgttgcacctct 24623218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24627347 - 24627228
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | || |||| |||| ||| ||| || ||    
24627347 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtnctaggatgggtgacctcctggga 24627248  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24627247 agtccttgtgttgcacctct 24627228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24627631 - 24627512
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24627631 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24627532  T
201 agttcttgtgttgcacctct 220  Q
    |||  |||||||||||||||    
24627531 agtcnttgtgttgcacctct 24627512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24631833 - 24631714
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||| ||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24631833 aggtgcgatcataccngcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24631734  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24631733 agtccttgtgttgcacctct 24631714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24626097 - 24625978
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
24626097 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 24625998  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||| ||||||||||    
24625997 agtccttgttttgcacctct 24625978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24634529 - 24634410
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | || |||| |||| ||| ||| || ||    
24634529 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtgctaggatgggtgacctcctggga 24634430  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24634429 agtccttgtgttgcacctct 24634410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24638573 - 24638454
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | || |||| |||| ||| ||| || ||    
24638573 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtgctaggatgggtgacctcctggga 24638474  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
24638473 agtccttgtgttgcacctct 24638454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 3348179 - 3348060
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||| ||||||||||  |||| || | |||||||||||||||| |||||||| |||| |||||||| | | ||||||| |||| ||| ||| |  ||    
3348179 aggtgcggtcataccagcgctaatgcaccggatcccatcagaactccgcagttaagcgtgcttggacgagagtagtactaggatgggtgacctcctagga 3348080  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
3348079 agtccttgtgttgcacctct 3348060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24621205 - 24621082
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24621205 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24621106  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24621105 gggaagtccttgtgttgcacctct 24621082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24635688 - 24635565
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24635688 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24635589  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24635588 gggaagtccttgtgttgcacctct 24635565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24636389 - 24636266
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24636389 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24636290  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24636289 gggaagtccttgtgttgcacctct 24636266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24636712 - 24636589
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24636712 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24636613  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24636612 gggaagtccttgtgttgcacctct 24636589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24639564 - 24639441
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24639564 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24639465  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24639464 gggaagtccttgtgttgcacctct 24639441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24640210 - 24640087
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | ||| |    
24640210 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctcct 24640111  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24640110 gggaagtccttgtgttgcacctct 24640087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24620882 - 24620760
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactaga---atggatgatctcatg 197  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | |||||||    |||| ||| ||| ||    
24620882 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactagntggatgggtgacctcctg 24620783  T
198 agaagttcttgtgttgcacctct 220  Q
     ||||| ||||||||||||||||    
24620782 ggaagtccttgtgttgcacctct 24620760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 101 - 189
Target Start/End: Complemental strand, 24637035 - 24636947
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg 189  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    
24637035 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatg 24636947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24625778 - 24625655
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatgga----tgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | |||||||  ||||    ||| ||| |    
24625778 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggntggatgggtgacctcct 24625679  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24625678 gggaagtccttgtgttgcacctct 24625655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24635365 - 24635242
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatg----atctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||||||    | |||      
24635365 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatggatgggtgacctccn 24635266  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24635265 gggaagtccttgtgttgcacctct 24635242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24621528 - 24621405
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtacta----gaatggatgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||    | |||| ||| ||| |    
24621528 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggnnggatgggtgacctcct 24621429  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24621428 gggaagtccttgtgttgcacctct 24621405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24626421 - 24626298
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgttt----ggacgaaaatggtactagaatggatgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| ||    || ||| | | ||||||| |||| ||| ||| |    
24626421 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcggccgagagtagtactaggatgggtgacctcct 24626322  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24626321 gggaagtccttgtgttgcacctct 24626298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24626744 - 24626621
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtac----tagaatggatgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||    ||| |||| ||| ||| |    
24626744 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggtaggatgggtgacctcct 24626645  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24626644 gggaagtccttgtgttgcacctct 24626621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 191
Target Start/End: Complemental strand, 24630946 - 24630856
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgat 191  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||||    
24630946 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgat 24630856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24637637 - 24637514
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtac----tagaatggatgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||    ||| |||| ||| ||| |    
24637637 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggtaggatgggtgacctcct 24637538  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24637537 gggaagtccttgtgttgcacctct 24637514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 24639887 - 24639764
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtacta----gaatggatgatctcat 196  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||    | |||| ||| ||| |    
24639887 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggnnggatgggtgacctcct 24639788  T
197 gagaagttcttgtgttgcacctct 220  Q
    | ||||| ||||||||||||||||    
24639787 gggaagtccttgtgttgcacctct 24639764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 165
Target Start/End: Complemental strand, 24637960 - 24637896
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttgg 165  Q
    ||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| ||||    
24637960 aggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgg 24637896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Complemental strand, 38802405 - 38802359
Alignment:
121 taatacatcagatcccatcagaactctgcagttaaacgtgtttggac 167  Q
    |||||||||||||||||||| ||| |||||||||| |||||||||||    
38802405 taatacatcagatcccatcaaaacactgcagttaagcgtgtttggac 38802359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 21825705 - 21825824
Alignment:
101 aggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgaga 200  Q
    ||||||||||||||||||| |||| || | |||||||||||||||||||||| || |||| |||| ||| | | ||||||| |||| ||| ||| || ||    
21825705 aggtgcgatcataccagcactaatgcaccggatcccatcagaactctgcagtcaagcgtgcttgggcgagagtagtactaggatgggtgacctcctggga 21825804  T
201 agttcttgtgttgcacctct 220  Q
    ||| ||||||||||||||||    
21825805 agtccttgtgttgcacctct 21825824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 25904851 - 25904730
Alignment:
100 taggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgag 199  Q
    |||||||||||||||||||| |||| || | |||||||||||||||| |||||||| ||| ||||||||| | | ||| ||  |||||||| ||  ||      
25904851 taggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtatttggacgagagtagtattaagatggatgaccttttgga 25904752  T
200 aagttcttgtgttgcacctctc 221  Q
    |||| |||||||||||||||||    
25904751 aagtccttgtgttgcacctctc 25904730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 99 - 165
Target Start/End: Complemental strand, 3153605 - 3153539
Alignment:
99 ttaggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttgg 165  Q
    ||||||||||||||||||||| |||| || | |||||||||||||||| |||||||| |||| ||||    
3153605 ttaggtgcgatcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgg 3153539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold1024
Description:

Target: scaffold1024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 109 - 220
Target Start/End: Original strand, 1 - 112
Alignment:
109 tcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttg 208  Q
    ||||||||||| |||| || | |||||||||||||||| |||||||| |||| |||| ||| | | ||||||| |||| ||| ||| || ||||| | ||    
1 tcataccagcactaatgcaccggatcccatcagaactccgcagttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctgggaagtccgtg 100  T
209 tgttgcacctct 220  Q
    ||||||||||||    
101 tgttgcacctct 112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 218
Target Start/End: Original strand, 3732644 - 3732763
Alignment:
99 ttaggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatga 198  Q
    ||||||||||||||||| ||| |||| || | ||||  |||||||||| |||||||| |||  |||| ||||| | |||||| ||||| ||| ||| | |    
3732644 ttaggtgcgatcataccggcactaatgcaccggatctgatcagaactccgcagttaagcgtacttgggcgaaagtagtactaaaatgggtgacctcttca 3732743  T
199 gaagttcttgtgttgcacct 218  Q
     |||| ||||||||||||||    
3732744 aaagtccttgtgttgcacct 3732763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 165
Target Start/End: Original strand, 16990034 - 16990097
Alignment:
102 ggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttgg 165  Q
    ||||||||||||||||||  ||| || | |||||||||||||||| ||||||||||||| ||||    
16990034 ggtgcgatcataccagcaccaatccaccggatcccatcagaactccgcagttaaacgtgcttgg 16990097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 127 - 166
Target Start/End: Original strand, 8861098 - 8861137
Alignment:
127 atcagatcccatcagaactctgcagttaaacgtgtttgga 166  Q
    |||||||| |||||||||||||||||||| ||||||||||    
8861098 atcagatctcatcagaactctgcagttaagcgtgtttgga 8861137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 165
Target Start/End: Original strand, 44836703 - 44836766
Alignment:
102 ggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcagttaaacgtgtttgg 165  Q
    |||||||||||||||||| ||||  | ||||||||||||||| |  |||||||||| |||||||    
44836703 ggtgcgatcataccagcactaatgtaccagatcccatcagaatttcgcagttaaacatgtttgg 44836766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 44174815 - 44174763
Alignment:
99 ttaggtgcgatcataccagcagtaatacatcagatcccatcagaactctgcag 151  Q
    ||||||||||||||||||||| |||| || | ||| |||||||||||| ||||    
44174815 ttaggtgcgatcataccagcactaatgcacctgattccatcagaactccgcag 44174763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 216
Target Start/End: Original strand, 2557869 - 2557949
Alignment:
135 ccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgttgcac 216  Q
    ||||||||| ||||||||||| ||||||||| ||| | | ||||||| |||| ||| ||| || ||||| ||||||||||||    
2557869 ccatcagaa-tctgcagttaagcgtgtttggccgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcac 2557949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 132 - 220
Target Start/End: Original strand, 65196 - 65284
Alignment:
132 atcccatcagaactctgcagttaaacgtgtttggacgaaaatggtactagaatggatgatctcatgagaagttcttgtgttgcacctct 220  Q
    ||||||||||||||| ||| |||| ||| ||| |||||||||  |||||  |||| ||| ||| ||| ||||  |||||||||||||||    
65196 atcccatcagaactccgcaattaagcgtatttagacgaaaataatactaagatgggtgacctcctgaaaagtctttgtgttgcacctct 65284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77671 times since January 2019
Visitors: 2276