View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-2 (Length: 423)

Name: F9296-LTR4-TNT-insertion-2
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-2
F9296-LTR4-TNT-insertion-2
[»] chr3 (23 HSPs)
chr3 (9-413)||(28035758-28036162)
chr3 (10-413)||(28002508-28002911)
chr3 (25-413)||(27918702-27919090)
chr3 (222-413)||(28148064-28148248)
chr3 (310-413)||(28053805-28053908)
chr3 (310-413)||(28064230-28064333)
chr3 (191-259)||(11419194-11419261)
chr3 (310-413)||(17745994-17746097)
chr3 (310-413)||(19047314-19047417)
chr3 (341-413)||(11419061-11419133)
chr3 (238-293)||(28481230-28481286)
chr3 (238-293)||(28510411-28510467)
chr3 (229-291)||(28159634-28159696)
chr3 (350-413)||(28481361-28481424)
chr3 (229-290)||(28184199-28184260)
chr3 (192-292)||(27460764-27460864)
chr3 (22-91)||(27979143-27979211)
chr3 (308-413)||(28132280-28132385)
chr3 (214-289)||(28082191-28082266)
chr3 (229-289)||(28053941-28054000)
chr3 (229-289)||(28064366-28064425)
chr3 (122-163)||(28159741-28159782)
chr3 (10-42)||(11419693-11419725)
[»] chr7 (1 HSPs)
chr7 (196-293)||(8693120-8693216)
[»] scaffold0257 (1 HSPs)
scaffold0257 (341-413)||(17659-17731)
[»] chr2 (2 HSPs)
chr2 (239-365)||(8020073-8020200)
chr2 (195-289)||(22391574-22391668)
[»] chr4 (1 HSPs)
chr4 (22-91)||(18010446-18010514)


Alignment Details
Target: chr3 (Bit Score: 405; Significance: 0; HSPs: 23)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 9 - 413
Target Start/End: Complemental strand, 28036162 - 28035758
Alignment:
9 aaaatcctcgtacaattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaaagacatacaatattgtc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28036162 aaaatcctcgtacaattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaaagacatacaatattgtc 28036063  T
109 tacttttaaagttttctattagataggttactccatgtgcccttacattttagaagattcagttatttatatcctttaacctattggtatgtttttgttg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28036062 tacttttaaagttttctattagataggttactccatgtgcccttacattttagaagattcagttatttatatcctttaacctattggtatgtttttgttg 28035963  T
209 ctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgcgtaccgtagtcaaactcgccagaa 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28035962 ctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgcgtaccgtagtcaaactcgccagaa 28035863  T
309 tataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaat 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28035862 tataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaat 28035763  T
409 gaatt 413  Q
    |||||    
28035762 gaatt 28035758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 10 - 413
Target Start/End: Complemental strand, 28002911 - 28002508
Alignment:
10 aaatcctcgtacaattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaaagacatacaatattgtct 109  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28002911 aaatccacgtacaattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaaagacatacaatattgtct 28002812  T
110 acttttaaagttttctattagataggttactccatgtgcccttacattttagaagattcagttatttatatcctttaacctattggtatgtttttgttgc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
28002811 acttttaaagttttctattagataggttactccatgtgcccttacattttagaagattcagttatttatatcctttaacctattgatatgtttttgttgc 28002712  T
210 tgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgcgtaccgtagtcaaactcgccagaat 309  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||  | | |||     
28002711 tgtaaatattaatgcttgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgtgtaccctcgtcaaaccagaccgaac 28002612  T
310 ataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatg 409  Q
     ||||||||||||||||||||| |||| || |||||||| ||||| |||||||||| ||||||||||| | |||| ||| |||||||||| || ||| ||    
28002611 gtaaaccagaaatatcattttcgaagtctgctgttgatgctgaagtcagagatagtttttgacaattcagtatgagacgatgttttacagcttcaaattg 28002512  T
410 aatt 413  Q
    ||||    
28002511 aatt 28002508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 25 - 413
Target Start/End: Complemental strand, 27919090 - 27918702
Alignment:
25 tcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaaagacatacaatattgtctacttttaaagttttc 124  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||||  ||| ||| |||||||||||| ||||||||||||||||||||||||||||    
27919090 tcataatctatggcaaagtaaatcaaaacgtctacttttaactctaaatagtcaatttcaagttcaaagacgtacaatattgtctacttttaaagttttc 27918991  T
125 tattagataggttactccatgtgcccttacattttagaagattcagttatttatatcctttaacctattggtatgttttt-gttgctgtaaatattagtg 223  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||  ||||||||||||||| ||    
27918990 tatttgataggttactccacatgcccttacattttagaagattcagttatttatatcctttaacctaatggtatgtttttatttgctgtaaatattaatg 27918891  T
224 catgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgcgtaccgtagtcaaactcgccagaatataaaccagaaata 323  Q
    |||||||||||||  ||| |||||||| |||||||||||||||| ||| |||||| |||| ||||||| |||||||  | |||||  |||||||||||||    
27918890 catgatatgtaat-tattgacagccaatatttaatagttttaaatataatggataaagtgtgtaccgttgtcaaaccagacagaaggtaaaccagaaata 27918792  T
324 tcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatgaatt 413  Q
    | |||||| |||| | |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
27918791 ttattttcgaagtctattgttgatgatgaagccagagatagtgtttgacaattctgtatgaaacgatgttttacagtttgaaaatgaatt 27918702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 222 - 413
Target Start/End: Complemental strand, 28148248 - 28148064
Alignment:
222 tgcatgatatgtaatcaatttacagccaacatttaatagttttaaaaa---tattggatagagtgcgtaccgtagtcaaactcgccagaatataaaccag 318  Q
    ||||||||||||||| | ||||| |||||||| |||||||||| ||||   |||||||||||||  ||||||||| |||| ||         | || |||    
28148248 tgcatgatatgtaatta-tttacggccaacatgtaatagtttttaaaaatatattggatagagtctgtaccgtagccaaaatc---------tgaagcag 28148159  T
319 aaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatgaatt 413  Q
    ||||||||||||| |||| || ||||||   |||||||||||||||| ||||||||||| | |||||||| |||||||||  |||||| ||||||    
28148158 aaatatcattttcgaagtctggtgttgactctgaagccagagatagtttttgacaattcagtatgaaacgatgttttacaacttgaaattgaatt 28148064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 413
Target Start/End: Complemental strand, 28053908 - 28053805
Alignment:
310 ataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatg 409  Q
    ||||| |||||||||||| ||| |||| |  |||||||| ||||| |||||||||| ||||||||||| | |||||||| |||||||||| |||||| ||    
28053908 ataaatcagaaatatcatattcgaagtctagtgttgatgctgaagtcagagatagtttttgacaattcagtatgaaacgatgttttacagcttgaaattg 28053809  T
410 aatt 413  Q
    ||||    
28053808 aatt 28053805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 413
Target Start/End: Complemental strand, 28064333 - 28064230
Alignment:
310 ataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatg 409  Q
    ||||| |||||||||||| ||| |||| |  |||||||| ||||| |||||||||| ||||||||||| | |||||||| |||||||||| |||||| ||    
28064333 ataaatcagaaatatcatattcgaagtctagtgttgatgctgaagtcagagatagtttttgacaattcagtatgaaacgatgttttacagcttgaaattg 28064234  T
410 aatt 413  Q
    ||||    
28064233 aatt 28064230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 259
Target Start/End: Complemental strand, 11419261 - 11419194
Alignment:
191 attggtatgtttttgttgctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaata 259  Q
    |||||||||||||||||||| ||||||||| |||||||||||||||  |||||||| |||||| |||||    
11419261 attggtatgtttttgttgctttaaatattaatgcatgatatgtaat-tatttacagacaacatgtaata 11419194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 413
Target Start/End: Original strand, 17745994 - 17746097
Alignment:
310 ataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatg 409  Q
    ||||||||  |||||||||||  | || || ||||| || |||||||||||| ||| ||||||||||| | |||||||| |||||||||| |||||| ||    
17745994 ataaaccacgaatatcatttttgaggtctgctgttgttgctgaagccagagagagtttttgacaattccgtatgaaacgatgttttacagcttgaaattg 17746093  T
410 aatt 413  Q
    ||||    
17746094 aatt 17746097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 413
Target Start/End: Original strand, 19047314 - 19047417
Alignment:
310 ataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatg 409  Q
    ||||||||  |||||||||||  | || || ||||| || |||||||||||| ||| ||||||||||| | |||||||| |||||||||| |||||| ||    
19047314 ataaaccacgaatatcatttttgaggtctgctgttgttgctgaagccagagagagtttttgacaattccgtatgaaacgatgttttacagcttgaaattg 19047413  T
410 aatt 413  Q
    ||||    
19047414 aatt 19047417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 413
Target Start/End: Complemental strand, 11419133 - 11419061
Alignment:
341 tgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatgaatt 413  Q
    ||||| ||||||||||||||| ||| ||||||||||||| |||||||| | |||||||| |||| | ||||||    
11419133 tgttgttgatgaagccagagagagtttttgacaattctgtatgaaacgatattttacagcttgatattgaatt 11419061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 28481230 - 28481286
Alignment:
238 aatttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtaccgtag 293  Q
    |||||||||||||||| |||||||||| |||||||||||||||| || |||||||||    
28481230 aatttacagccaacatgtaatagttttaaaaaatattggatagaatgtgtaccgtag 28481286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 238 - 293
Target Start/End: Original strand, 28510411 - 28510467
Alignment:
238 aatttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtaccgtag 293  Q
    |||||||||||||||| |||||||||| |||||||||||||||| || |||||||||    
28510411 aatttacagccaacatgtaatagttttaaaaaatattggatagaatgtgtaccgtag 28510467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 291
Target Start/End: Complemental strand, 28159696 - 28159634
Alignment:
229 tatgtaatcaatttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtaccgt 291  Q
    |||||||| |||||||||| ||||| |||||||||| ||||||||||||||||||| |||||||    
28159696 tatgtaat-aatttacagcaaacatgtaatagtttttaaaaatattggatagagtgtgtaccgt 28159634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 350 - 413
Target Start/End: Original strand, 28481361 - 28481424
Alignment:
350 tgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatgaatt 413  Q
    |||||||||||| ||| ||||||||||| | |||||||| |||||||||| |||||| ||||||    
28481361 tgaagccagagagagtttttgacaattcagtatgaaacgatgttttacagcttgaaattgaatt 28481424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 229 - 290
Target Start/End: Complemental strand, 28184260 - 28184199
Alignment:
229 tatgtaatcaatttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtaccg 290  Q
    |||||||| |||||||||| ||||| |||||||||| ||||||||||||||||||| ||||||    
28184260 tatgtaat-aatttacagcaaacatgtaatagtttttaaaaatattggatagagtgtgtaccg 28184199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 192 - 292
Target Start/End: Original strand, 27460764 - 27460864
Alignment:
192 ttggtatgtttttgttgctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaat-agttttaaaaatattggatagagtgcgtaccg 290  Q
    |||||||||||| ||| || ||||||||| ||||||||||| ||   ||||||||||||||| |||| | ||| | ||| ||||||||||||| ||||||    
27460764 ttggtatgttttcgtttctctaaatattactgcatgatatgcaa-atatttacagccaacatgtaatgattttcagaaagattggatagagtgtgtaccg 27460862  T
291 ta 292  Q
    ||    
27460863 ta 27460864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 91
Target Start/End: Complemental strand, 27979211 - 27979143
Alignment:
22 aattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaa 91  Q
    ||||| ||||||||| ||||||||||||||  ||| ||||||||||||||||  ||||||| ||||||||    
27979211 aattcgtaatctatatcaaagcaaatcaaat-gtccacttttaactctaaatcgtcattttcaagttcaa 27979143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 413
Target Start/End: Complemental strand, 28132385 - 28132280
Alignment:
308 atataaaccagaaatatcattttcaaagtttgttgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaa 407  Q
    ||||||||| |||| ||| |||| ||||| ||  |||  || ||||| |||||| ||| ||||||||||||| |||||||| |||||||||  ||||||     
28132385 atataaaccggaaagatcctttttaaagtctgcggttattgctgaagtcagagagagtttttgacaattctgtatgaaacgatgttttacatcttgaaat 28132286  T
408 tgaatt 413  Q
    ||||||    
28132285 tgaatt 28132280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 289
Target Start/End: Complemental strand, 28082266 - 28082191
Alignment:
214 aatattagtgcatgatatgtaatcaatttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtacc 289  Q
    ||||||| |||||| ||| |||| ||||||||| |||||| |||||||||| |||||||||||||||| || |||||    
28082266 aatattaatgcatggtatataat-aatttacagtcaacatgtaatagtttttaaaaatattggatagaatgtgtacc 28082191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 289
Target Start/End: Complemental strand, 28054000 - 28053941
Alignment:
229 tatgtaatcaatttacagccaacatttaatagttttaaa-aatattggatagagtgcgtacc 289  Q
    |||||||| ||||||||||||||||| ||||||||| || |||||||||||||||| |||||    
28054000 tatgtaat-aatttacagccaacatt-aatagtttttaagaatattggatagagtgtgtacc 28053941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 289
Target Start/End: Complemental strand, 28064425 - 28064366
Alignment:
229 tatgtaatcaatttacagccaacatttaatagttttaaa-aatattggatagagtgcgtacc 289  Q
    |||||||| ||||||||||||||||| ||||||||| || |||||||||||||||| |||||    
28064425 tatgtaat-aatttacagccaacatt-aatagtttttaagaatattggatagagtgtgtacc 28064366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 163
Target Start/End: Complemental strand, 28159782 - 28159741
Alignment:
122 ttctattagataggttactccatgtgcccttacattttagaa 163  Q
    ||||||||||||||| ||| |||| |||||||||||||||||    
28159782 ttctattagataggtcactacatgagcccttacattttagaa 28159741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 11419725 - 11419693
Alignment:
10 aaatcctcgtacaattcataatctatagcaaag 42  Q
    ||||| |||||||||||||||||||||||||||    
11419725 aaatcgtcgtacaattcataatctatagcaaag 11419693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 196 - 293
Target Start/End: Original strand, 8693120 - 8693216
Alignment:
196 tatgtttttgttgctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaatagttttaaaaatattggatagagtgcgtaccgtag 293  Q
    ||||||||||||||| ||||||||| ||||||||||||||| | |||||||||||| | ||||||||| ||||||||||||||||||| |||||||||    
8693120 tatgtttttgttgctataaatattaatgcatgatatgtaatta-tttacagccaacgtgtaatagtttaaaaaatattggatagagtgtgtaccgtag 8693216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0257 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0257
Description:

Target: scaffold0257; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 413
Target Start/End: Complemental strand, 17731 - 17659
Alignment:
341 tgttgatgatgaagccagagatagtgtttgacaattctgcatgaaacgttgttttacagtttgaaaatgaatt 413  Q
    |||||||| |||||||||||||||| ||||||||||||| |||||||| | |||||||| |||||| ||||||    
17731 tgttgatgctgaagccagagatagtttttgacaattctgtatgaaacggtattttacagcttgaaattgaatt 17659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 239 - 365
Target Start/End: Complemental strand, 8020200 - 8020073
Alignment:
239 atttacagccaacatttaatagtttt-aaaaatattggatagagtgcgtaccgtagtcaaactcgccagaatataaaccagaaatatcattttcaaagtt 337  Q
    ||||||||||||| | |||||||||| |||||||||| |||||||| ||||||||| |||||| || || ||||||||||  |||||||  |   ||||     
8020200 atttacagccaacgtgtaatagtttttaaaaatattgtatagagtgtgtaccgtagccaaacttgctagcatataaaccattaatatcaaatatgaagtc 8020101  T
338 tgttgttgatgatgaagccagagatagt 365  Q
    || |||||||| ||||||||| ||||||    
8020100 tgctgttgatgctgaagccagggatagt 8020073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 195 - 289
Target Start/End: Complemental strand, 22391668 - 22391574
Alignment:
195 gtatgtttttgttgctgtaaatattagtgcatgatatgtaatcaatttacagccaacatttaatag-ttttaaaaatattggatagagtgcgtacc 289  Q
    |||||||||||||||||||||||||| || ||||| |||||| || ||||||||||||| |||||| ||| |||||||||||| | |||| |||||    
22391668 gtatgtttttgttgctgtaaatattactgtatgatgtgtaattaa-ttacagccaacatgtaatagatttcaaaaatattggacaaagtgtgtacc 22391574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 91
Target Start/End: Complemental strand, 18010514 - 18010446
Alignment:
22 aattcataatctatagcaaagcaaatcaaaacgtctacttttaactctaaatgttcatttttaagttcaa 91  Q
    ||||| ||||||||| ||||||||||||||  ||| ||||||||||||||||  ||||||| ||||||||    
18010514 aattcgtaatctatatcaaagcaaatcaaat-gtccacttttaactctaaatcgtcattttcaagttcaa 18010446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84135 times since January 2019
Visitors: 2323