View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-3 (Length: 770)

Name: F9296-LTR4-TNT-insertion-3
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-3
F9296-LTR4-TNT-insertion-3
[»] chr2 (1 HSPs)
chr2 (7-761)||(32529028-32529782)


Alignment Details
Target: chr2 (Bit Score: 755; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 755; E-Value: 0
Query Start/End: Original strand, 7 - 761
Target Start/End: Original strand, 32529028 - 32529782
Alignment:
7 aggtacctcaaagaggtcttggtgtagcacagcttgaaaaaattcttgaagaacaacacatgaaagatggtgttgtaatttcaccatcacaaaattctac 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529028 aggtacctcaaagaggtcttggtgtagcacagcttgaaaaaattcttgaagaacaacacatgaaagatggtgttgtaatttcaccatcacaaaattctac 32529127  T
107 atcatcatcacaaaattctatttcagcttatttgcctcctccaattaaaaattataatcactcaaaagatggtactataattttaccatcaccaaattct 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529128 atcatcatcacaaaattctatttcagcttatttgcctcctccaattaaaaattataatcactcaaaagatggtactataattttaccatcaccaaattct 32529227  T
207 gcatcatcatctacatcaccatcatccatatcaaactttttacctcttccaattaccaattttaatctcatgaaccaaaattcttctacaaagcctttac 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529228 gcatcatcatctacatcaccatcatccatatcaaactttttacctcttccaattaccaattttaatctcatgaaccaaaattcttctacaaagcctttac 32529327  T
307 ctttaccatcattagatgagtttagatcttcaatttcaatgcaacattttaatggtaaagctcctagtactgttccattgcctaatagtggtatgtttgg 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529328 ctttaccatcattagatgagtttagatcttcaatttcaatgcaacattttaatggtaaagctcctagtactgttccattgcctaatagtggtatgtttgg 32529427  T
407 gaatgtgcctaagttatggaactctcatgagttagattttgagaaggaaaattttggtgttcaacatggattaccatttctaccaagttttccttttgaa 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529428 gaatgtgcctaagttatggaactctcatgagttagattttgagaaggaaaattttggtgttcaacatggattaccatttctaccaagttttccttttgaa 32529527  T
507 tcaaatcaaatttggcctatgcctaattgggtccaaagaccaccacagtttcatcatcaacattcttcacaagtggtaacatacattttatttaatttat 606  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529528 tcaaatcaaatttggcctatgcctaattgggtccaaagaccaccacagtttcatcatcaacattcttcacaagtggtaacatacattttatttaatttat 32529627  T
607 ggttttcatatgttaatttctatgatttggtttatatttggcatcattttgtgaattttgtatctatggaatatgaaagatttgattttgatacatgtag 706  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529628 ggttttcatatgttaatttctatgatttggtttatatttggcatcattttgtgaattttgtatctatggaatatgaaagatttgattttgatacatgtag 32529727  T
707 gtgagtaacagcatatcaggaacttcatcaacacatgtgcctcaactgtcaattg 761  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32529728 gtgagtaacagcatatcaggaacttcatcaacacatgtgcctcaactgtcaattg 32529782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98536 times since January 2019
Visitors: 2275