View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-4 (Length: 308)

Name: F9296-LTR4-TNT-insertion-4
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-4
F9296-LTR4-TNT-insertion-4
[»] chr6 (3 HSPs)
chr6 (10-300)||(30896456-30896746)
chr6 (10-64)||(17778716-17778770)
chr6 (10-62)||(6945241-6945293)


Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 10 - 300
Target Start/End: Original strand, 30896456 - 30896746
Alignment:
10 caaaagcgcgggttccagcaccattcataaaacaaacatgttgcaatcttcaatccttcttacaactcattgaatctattgaatctgaatttttaccctt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30896456 caaaagcgcgggttccagcaccattcataaaacaaacatgttgcaatcttcaatccttcttacaactcattgaatctattgaatctgaatttttaccctt 30896555  T
110 ctcttcaaaatccttttgtagtaagcgaccatttctctttctacttctattaggggaaacactttgacataaaaaagagaaaattggaataaccgatacc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30896556 ctcttcaaaatccttttgtagtaagcgaccatttctctttctacttctattaggggaaacactttgacataaaaaagagaaaattggaataaccgatacc 30896655  T
210 atttaatacaagtgacatacaaatatatattaaataaaatcaactaaaatgtagcattcatttccaaatcttgttgaaaatcttggcatta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30896656 atttaatacaagtgacatacaaatatatattaaataaaatcaactaaaatgtagcattcatttccaaatcttgttgaaaattttggcatta 30896746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 17778770 - 17778716
Alignment:
10 caaaagcgcgggttccagcaccattcataaaacaaacatgttgcaatcttcaatc 64  Q
    |||||| ||||||||||| |||||| | ||||||||||||||||||| |||||||    
17778770 caaaagggcgggttccaggaccatttagaaaacaaacatgttgcaattttcaatc 17778716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 6945241 - 6945293
Alignment:
10 caaaagcgcgggttccagcaccattcataaaacaaacatgttgcaatcttcaa 62  Q
    |||||||| |||||||| ||||| || ||||||||||| |||||||| |||||    
6945241 caaaagcgagggttccatcaccactcgtaaaacaaacaagttgcaatgttcaa 6945293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC