View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-5 (Length: 178)

Name: F9296-LTR4-TNT-insertion-5
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-5
F9296-LTR4-TNT-insertion-5
[»] chr3 (6 HSPs)
chr3 (7-169)||(6935169-6935331)
chr3 (7-96)||(50302087-50302173)
chr3 (7-71)||(6799211-6799275)
chr3 (9-71)||(6410625-6410687)
chr3 (7-58)||(6525438-6525489)
chr3 (84-124)||(6799135-6799175)
[»] chr1 (1 HSPs)
chr1 (99-167)||(49619197-49619265)
[»] chr7 (1 HSPs)
chr7 (121-168)||(39382447-39382494)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 6e-85; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 7 - 169
Target Start/End: Original strand, 6935169 - 6935331
Alignment:
7 agttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacccggaatccaaacaacatgcacatagggagtgatttacctaaagaggaa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6935169 agttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacccggaatccaaacaacatgcacatagggagtgatttacctaaagaggaa 6935268  T
107 aacgatgtgctgggaactaaaaagacaaatctgagaggaaattgaatcaccatactacaattg 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
6935269 aacgatgtgctgggaactaaaaagacaaatctgagaggaaattgaatcaccatactgcaattg 6935331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 50302173 - 50302087
Alignment:
7 agttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacccggaatccaaacaacatgcacatagggagtgatttacc 96  Q
    ||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||   |||||||||| ||||||| |||||||    
50302173 agttcaaaaatataaattttgacaaaattgccacaattcaatcaaattcacacggaaccca---aacatgcacaaagggagtaatttacc 50302087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 6799275 - 6799211
Alignment:
7 agttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacccggaatccaaaca 71  Q
    ||||||||| || |||||| ||||||||| |||||||||||||||||||||| |||||| |||||    
6799275 agttcaaaagtacaaattttgacaaaattaccacaattctatcaaattcaccgggaatcaaaaca 6799211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 71
Target Start/End: Complemental strand, 6410687 - 6410625
Alignment:
9 ttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacccggaatccaaaca 71  Q
    ||||||| ||||||||| |||||||||  ||||||||||||||||||||| |||||| |||||    
6410687 ttcaaaagtataaattttgacaaaattatcacaattctatcaaattcacctggaatcaaaaca 6410625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 6525489 - 6525438
Alignment:
7 agttcaaaaatataaatttggacaaaattgccacaattctatcaaattcacc 58  Q
    ||||||||| ||||||||| ||||||||| |||| |||||||||||||||||    
6525489 agttcaaaagtataaattttgacaaaattaccacgattctatcaaattcacc 6525438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 84 - 124
Target Start/End: Complemental strand, 6799175 - 6799135
Alignment:
84 ggagtgatttacctaaagaggaaaacgatgtgctgggaact 124  Q
    ||||| ||||||||||| ||||||| |||||||||||||||    
6799175 ggagtaatttacctaaataggaaaaagatgtgctgggaact 6799135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 99 - 167
Target Start/End: Original strand, 49619197 - 49619265
Alignment:
99 aagaggaaaacgatgtgctgggaactaaaaagacaaatctgagaggaaattgaatcaccatactacaat 167  Q
    |||||||| | ||||||| |||||||||||||| |||||||||  ||||||||||||||| ||| ||||    
49619197 aagaggaagaagatgtgcagggaactaaaaagataaatctgagcagaaattgaatcaccacacttcaat 49619265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 121 - 168
Target Start/End: Complemental strand, 39382494 - 39382447
Alignment:
121 aactaaaaagacaaatctgagaggaaattgaatcaccatactacaatt 168  Q
    ||||||||||| |||||||||  ||||||||||||||| ||| |||||    
39382494 aactaaaaagataaatctgagcagaaattgaatcaccacactccaatt 39382447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC