View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9296-LTR4-TNT-insertion-8 (Length: 818)

Name: F9296-LTR4-TNT-insertion-8
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9296-LTR4-TNT-insertion-8
F9296-LTR4-TNT-insertion-8
[»] chr8 (1 HSPs)
chr8 (8-818)||(2094461-2095271)


Alignment Details
Target: chr8 (Bit Score: 779; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 779; E-Value: 0
Query Start/End: Original strand, 8 - 818
Target Start/End: Complemental strand, 2095271 - 2094461
Alignment:
8 tggggaacaaattgcataatattatcagatttgaggtctaattgtttaagccttctggtgtgctctattgcacattagcatttaatcgaaatttggaagc 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2095271 tggggaacaaattgcataatattatcagatttgaggtctaattgtttaagccttctggtgtgctctattgcacattagcatttaattgaaatttggaagc 2095172  T
108 gatcttataataaaggacaccggttagcatttcaataaattgcaaaattcaacgattattttgatggatggtcatagactcatagtttccgatactaaac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2095171 gatcttataataaaggacaccggttagcatttcaataaattgcaaaattcaacgattattttgatggatggtcatagactcatagtttccgatactaaac 2095072  T
208 ctcggtgtgcccatttggctatatcttgatcttcaaaggtccaccaccacactaaagtcaattattattattatttttggctttttacagttgtgaccac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2095071 ctcggtgtgcccatttggctatatcttgatcttcaaaggtccaccaccacactaaagtcaattattattattatttttggctttttacagttgtgaccac 2094972  T
308 ggcaattttacaacaatattattcccccattcctgaagtattttatactcaagcattatgttccacaacttttagctcttgaagggtacttatgcaaatg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2094971 ggcaattttacaacaatattattcccccattcctgaagtattttatactcaagcattatgttccacaacttttagctcttgaagggtacttatgcaaatg 2094872  T
408 tttgtccaaatccacgaaattttgcctcttgcttttgcatgaaattgaataaataaactgaaatgtatattaagcaccagaatttggcacgaggcagtga 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2094871 tttgtccaaatccacgaaattttgcctcttgcttttgcatgaaattgaataaataaactgaaatgtatattaagcaccagaatttggcacgaggcagtga 2094772  T
508 ggcaccatattctaaacactgatttccgattttatgttcattatttatctcttttcatgatatgaaaacattaaaattagatgtatttattttataaggt 607  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2094771 ggcaccatattctaaacactgatttccgattttatgttcattatttatctcttttcataatatgaaaacattaaaattagatgtatttattttataaggt 2094672  T
608 gctggatatatgagcaacacttctatgctcacgaacacaaatgtttctgatttaggtgctaaaaaatgataaaataattttctaatttgtatcatttgtg 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2094671 gctggatatatgagcaacacttctatgctcacgaacacaaatgtttctgatttaggtgctaaaaaatgataaaataattttctaatttgtatcatttgtg 2094572  T
708 tgtgtaacaaaataaactgtgtcataatccaaaatatttatggttgtgatcatacaagtgttgctagccggatacattccttgaannnnnnnnaccaaaa 807  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||    
2094571 tgtgtaacaaaataaactgtgtcataatccaaaatatttatggttgtgatcatacaagtgttgctagccggatacattccttgaatttttttaaccaaaa 2094472  T
808 catcattgctt 818  Q
    |||||||||||    
2094471 catcattgctt 2094461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93695 times since January 2019
Visitors: 2365