View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-3 (Length: 642)

Name: F9301-LTR4-TNT-insertion-3
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9301-LTR4-TNT-insertion-3
F9301-LTR4-TNT-insertion-3
[»] chr5 (1 HSPs)
chr5 (11-632)||(2949314-2949934)


Alignment Details
Target: chr5 (Bit Score: 581; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 581; E-Value: 0
Query Start/End: Original strand, 11 - 632
Target Start/End: Original strand, 2949314 - 2949934
Alignment:
11 gaaattctagaaccacttgaagaaaataatataaatttgtgatttcaaatagtttttcgtgaagttggttgttaaaagagctgtactagtagttggagat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2949314 gaaattctagaaccacttgaagaaaataatataaatttgtgatttcaaatagtttttcgtgaagttggttgttaaaagagctgtactagtagttggagat 2949413  T
111 agaatagaataattgaaattatatatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
2949414 agaatagaataattgaaattatatatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgc 2949513  T
211 tacgcagtgcatgatatgtctcttaattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattannnnnnncattatccttat 310  Q
    || ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
2949514 ta-gccttgcatgatatgtctcttaattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattatttttttcattatccttat 2949612  T
311 tatggtaaagagtccctataatacaaaagtaagcaggtgtatatgccagtttttaaggagatttttcctagatttgatgagtgagttatgtatttgtctg 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2949613 tatggtaaagagtccctataatacaaaagtaagcaggtgtatatgccagtttttaaggagatttttcctagatttgatgagtgagttatgtatttgtctg 2949712  T
411 accaaaataggcatctcaagtaaatctactcatggatatcattgaatgcttcaactcctaaacttgtttgtaatgctttgttcgacttgaaatctttcca 510  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2949713 accaaaataggcatctcaagtaaatctactcatggatatcattgaatgcttcaactcctaaacttgtttgtaatgctttgttcgacttgaaatctttcca 2949812  T
511 atatctatactaaattttcaacaggaggcacatacatacttttcctaatccttcatttttatgtagaggaaaatcttttgatagatcttttttctcagca 610  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2949813 atatctatactaaattttcaacaggaggcacatacatacttttcctaatccttcatttttatgtagaggaaaatcttttgatagatcttttttctcagca 2949912  T
611 accaaaatggatatataaatta 632  Q
    ||||||||||||||||||||||    
2949913 accaaaatggatatataaatta 2949934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC