View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-3 (Length: 642)

Name: F9301-LTR4-TNT-insertion-3
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9301-LTR4-TNT-insertion-3
[»] chr5 (1 HSPs)
chr5 (11-632)||(2949314-2949934)

Alignment Details
Target: chr5 (Bit Score: 581; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 581; E-Value: 0
Query Start/End: Original strand, 11 - 632
Target Start/End: Original strand, 2949314 - 2949934
11 gaaattctagaaccacttgaagaaaataatataaatttgtgatttcaaatagtttttcgtgaagttggttgttaaaagagctgtactagtagttggagat 110  Q
2949314 gaaattctagaaccacttgaagaaaataatataaatttgtgatttcaaatagtttttcgtgaagttggttgttaaaagagctgtactagtagttggagat 2949413  T
111 agaatagaataattgaaattatatatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgg 210  Q
2949414 agaatagaataattgaaattatatatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgc 2949513  T
211 tacgcagtgcatgatatgtctcttaattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattannnnnnncattatccttat 310  Q
    || ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
2949514 ta-gccttgcatgatatgtctcttaattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattatttttttcattatccttat 2949612  T
311 tatggtaaagagtccctataatacaaaagtaagcaggtgtatatgccagtttttaaggagatttttcctagatttgatgagtgagttatgtatttgtctg 410  Q
2949613 tatggtaaagagtccctataatacaaaagtaagcaggtgtatatgccagtttttaaggagatttttcctagatttgatgagtgagttatgtatttgtctg 2949712  T
411 accaaaataggcatctcaagtaaatctactcatggatatcattgaatgcttcaactcctaaacttgtttgtaatgctttgttcgacttgaaatctttcca 510  Q
2949713 accaaaataggcatctcaagtaaatctactcatggatatcattgaatgcttcaactcctaaacttgtttgtaatgctttgttcgacttgaaatctttcca 2949812  T
511 atatctatactaaattttcaacaggaggcacatacatacttttcctaatccttcatttttatgtagaggaaaatcttttgatagatcttttttctcagca 610  Q
2949813 atatctatactaaattttcaacaggaggcacatacatacttttcctaatccttcatttttatgtagaggaaaatcttttgatagatcttttttctcagca 2949912  T
611 accaaaatggatatataaatta 632  Q
2949913 accaaaatggatatataaatta 2949934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84197 times since January 2019
Visitors: 2323