View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-5 (Length: 255)

Name: F9301-LTR4-TNT-insertion-5
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9301-LTR4-TNT-insertion-5
F9301-LTR4-TNT-insertion-5
[»] chr1 (1 HSPs)
chr1 (10-247)||(32094722-32094959)


Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 32094722 - 32094959
Alignment:
10 gagcagacacgaagttccaaccacgaaaaaagccaggttgatatatgttgcttgatcactttgaaatggaagttaattcttgcatggaaaaagccaattt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32094722 gagcagacacgaagttccaaccacgaaaaaagccaggttgatatatgttgcttgatcactttgaaatggaagttaattcttgcatggaaaaagccaattt 32094821  T
110 tttcacattccaatgcaatattttcgcgattttaagaagttatataatgaaatctttgtttaataaagagttatatttgttttgcagcttgtgcacctgt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32094822 tttcacattccaatgcaatattttcgcgattttaagaagttatataatgaaatctttgtttaataaagagttatatttgttttgcagcttgtgcacctgt 32094921  T
210 cctccttcccgcccgagttgttcaagctctaaatatta 247  Q
    ||||||||||||||||||||||||||||||||||||||    
32094922 cctccttcccgcccgagttgttcaagctctaaatatta 32094959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105603 times since January 2019
Visitors: 2328