View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-6 (Length: 543)

Name: F9301-LTR4-TNT-insertion-6
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9301-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-533)||(10550032-10550557)

Alignment Details
Target: chr1 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Original strand, 10550032 - 10550557
8 cttaaccagacagttttttcacctaaattcctgaacttaactgaaactcccgtgcatttggttgctgtcaagattaaaaagaagctatagagaaagtaag 107  Q
10550032 cttaaccagacagttttttcacctaaattcctgaacttaactgaaactcccgtgcatttggttgctgtcaagattaaaaagaagctatagagaaagtaag 10550131  T
108 aaatagacagtagagcgtagcatcattaggaaactccactttatatcatatatttcaaaggaannnnnnnnaaactccaaaactttattatggagagtaa 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
10550132 aaatagacagtagagcgtagcatcattaggaaactccactttatatcatatatttcaaaggaattttttttaaactccaaaactttattatggagagtaa 10550231  T
208 ggactattaacaaatcaccaagaaattattcactctaacaaatgtagaaaaaacattcatagaaactacannnnnnnccccgataaatcatagaaacttc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||    
10550232 ggactattaacaaatcaccaagaaattattcactctaacaaatgtagaaaaaacattcatagaaactacatttttttccccgataaatcatagaaacttc 10550331  T
308 atgttgattttttcctcgaatcgttttcccattcccacaagaggttcttcatagaccttctgtccacttgatcacnnnnnnnnnnnncaagtccaaatat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||    
10550332 atgttgattttttcctcgaatcgttttcccattcccacaagaggttcttcatagaccttctgtccacttgatcacaaaaaataaaaacaagtccaaatat 10550431  T
408 atgaaccctaatttcgaagcaaggttgagaagatatataaagacggagtgatcacgattaacaaaggaagatgggagggagtacgcacgatcaactctac 507  Q
10550432 atgaaccctaatttcgaagcaaggttgagaagatatataaagacggagtgatcacgattaacaaaggaagatgggagggagtacgcacgatcaactctac 10550531  T
508 attcaatataacttaaaaataaatta 533  Q
10550532 attcaatataacttaaaaataaatta 10550557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC