View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-6 (Length: 543)

Name: F9301-LTR4-TNT-insertion-6
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9301-LTR4-TNT-insertion-6
F9301-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-533)||(10550032-10550557)


Alignment Details
Target: chr1 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 8 - 533
Target Start/End: Original strand, 10550032 - 10550557
Alignment:
8 cttaaccagacagttttttcacctaaattcctgaacttaactgaaactcccgtgcatttggttgctgtcaagattaaaaagaagctatagagaaagtaag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10550032 cttaaccagacagttttttcacctaaattcctgaacttaactgaaactcccgtgcatttggttgctgtcaagattaaaaagaagctatagagaaagtaag 10550131  T
108 aaatagacagtagagcgtagcatcattaggaaactccactttatatcatatatttcaaaggaannnnnnnnaaactccaaaactttattatggagagtaa 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
10550132 aaatagacagtagagcgtagcatcattaggaaactccactttatatcatatatttcaaaggaattttttttaaactccaaaactttattatggagagtaa 10550231  T
208 ggactattaacaaatcaccaagaaattattcactctaacaaatgtagaaaaaacattcatagaaactacannnnnnnccccgataaatcatagaaacttc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||    
10550232 ggactattaacaaatcaccaagaaattattcactctaacaaatgtagaaaaaacattcatagaaactacatttttttccccgataaatcatagaaacttc 10550331  T
308 atgttgattttttcctcgaatcgttttcccattcccacaagaggttcttcatagaccttctgtccacttgatcacnnnnnnnnnnnncaagtccaaatat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||    
10550332 atgttgattttttcctcgaatcgttttcccattcccacaagaggttcttcatagaccttctgtccacttgatcacaaaaaataaaaacaagtccaaatat 10550431  T
408 atgaaccctaatttcgaagcaaggttgagaagatatataaagacggagtgatcacgattaacaaaggaagatgggagggagtacgcacgatcaactctac 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10550432 atgaaccctaatttcgaagcaaggttgagaagatatataaagacggagtgatcacgattaacaaaggaagatgggagggagtacgcacgatcaactctac 10550531  T
508 attcaatataacttaaaaataaatta 533  Q
    ||||||||||||||||||||||||||    
10550532 attcaatataacttaaaaataaatta 10550557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93590 times since January 2019
Visitors: 2365