View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-9 (Length: 199)

Name: F9301-LTR4-TNT-insertion-9
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9301-LTR4-TNT-insertion-9
F9301-LTR4-TNT-insertion-9
[»] chr1 (1 HSPs)
chr1 (8-189)||(30666059-30666240)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 30666059 - 30666240
Alignment:
8 ccatatacatttgagtaagaacgtgtttgtacccgtaactttttnnnnnnnggaaaatgctaacggcctctagagcactgattgagaaataaatatagta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
30666059 ccatatacatttgagtaagaacgtgtttgtacccgtaactttttaaaaaaaggaaaatgctaacggcctctagagcactgattgagaaataaatatagta 30666158  T
108 aagttagcttaaattcgtgttgtgaaactcttaaaagtttacaaaatgttttttcaatataaattttacccttgtgaaatta 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30666159 aagttagcttaaattcgtgttgtgaaactcttaaaagtttacaaaatgttttttcaatataaattttacccttgtgaaatta 30666240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98483 times since January 2019
Visitors: 2275