View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9302-LTR4-TNT-insertion-2 (Length: 700)

Name: F9302-LTR4-TNT-insertion-2
Description: F9302-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9302-LTR4-TNT-insertion-2
F9302-LTR4-TNT-insertion-2
[»] chr1 (4 HSPs)
chr1 (7-690)||(24030292-24030975)
chr1 (617-690)||(24030036-24030109)
chr1 (617-690)||(24033235-24033308)
chr1 (617-685)||(24033809-24033877)


Alignment Details
Target: chr1 (Bit Score: 684; Significance: 0; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 684; E-Value: 0
Query Start/End: Original strand, 7 - 690
Target Start/End: Complemental strand, 24030975 - 24030292
Alignment:
7 agttctgataagaggttctcatgattagtccattatcaatgtatctttaaaccaagaaaatgggaaagttaaaggatttacctttcttttggccgtgtgc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030975 agttctgataagaggttctcatgattagtccattatcaatgtatctttaaaccaagaaaatgggaaagttaaaggatttacctttcttttggccgtgtgc 24030876  T
107 ctgtcattgccgccatacttcctgttaaatacgtctatttgtctgttcaaaaactcaaatttctctttatccgatcccaacttcaagaatagattaccat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030875 ctgtcattgccgccatacttcctgttaaatacgtctatttgtctgttcaaaaactcaaatttctctttatccgatcccaacttcaagaatagattaccat 24030776  T
207 aggaagccttttcaaggaagagatgctcaagttccccaagctcttccattatgaaatcatagttagttgcgatccttttaagatcaaatgttgattccac 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030775 aggaagccttttcaaggaagagatgctcaagttccccaagctcttccattatgaaatcatagttagttgcgatccttttaagatcaaatgttgattccac 24030676  T
307 tttggggtcgaatgacctggcttgcacggaaacaatacccccacttatcgaagattcgccatcacctgttcaagttttaatcaatatgtaccaaaatgaa 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030675 tttggggtcgaatgacctggcttgcacggaaacaatacccccacttatcgaagattcgccatcacctgttcaagttttaatcaatatgtaccaaaatgaa 24030576  T
407 catttgattacaataaaaatcataaatttagaagagagatatatacccctgctgttacaatgttgaaatacacctttattttcaagtaatagttgattgt 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030575 catttgattacaataaaaatcataaatttagaagagagatatatacccctgctgttacaatgttgaaatacacctttattttcaagtaatagttgattgt 24030476  T
507 ccggattacaatagtacttgagcgaaagaaggggacccagtccatcttggttcaaagaagggctttgtagttgaccaagattgctatccaaaggtgcaaa 606  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030475 ccggattacaatagtacttgagcgaaagaaggggacccagtccatcttggttcaaagaagggctttgtagttgaccaagattgctatccaaaggtgcaaa 24030376  T
607 caccttgatcattttggacatataattttgctcaactaatctcttaaattttttgagattgtttgctattttactcatagatta 690  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24030375 caccttgatcattttggacatataattttgctcaactaatctcttaaattttttgagattgtttgctattttactcatagatta 24030292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 617 - 690
Target Start/End: Complemental strand, 24030109 - 24030036
Alignment:
617 attttggacatataattttgctcaactaatctcttaaattttttgagattgtttgctattttactcatagatta 690  Q
    |||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
24030109 attttgaacatataattctgctcgactaatctcttaaattttttgagattgtttgctattttactcatagatta 24030036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 617 - 690
Target Start/End: Original strand, 24033235 - 24033308
Alignment:
617 attttggacatataattttgctcaactaatctcttaaattttttgagattgtttgctattttactcatagatta 690  Q
    |||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
24033235 attttgaacatataattctgctcgactaatctcttaaattttttgagattgtttgctattttactcatagatta 24033308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 617 - 685
Target Start/End: Original strand, 24033809 - 24033877
Alignment:
617 attttggacatataattttgctcaactaatctcttaaattttttgagattgtttgctattttactcata 685  Q
    |||||| |||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||    
24033809 attttgaacatataattctactcgactaatctcttaaattttttgagattgtttgctattttactcata 24033877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC