View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9302-LTR4-TNT-insertion-3 (Length: 594)

Name: F9302-LTR4-TNT-insertion-3
Description: F9302-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9302-LTR4-TNT-insertion-3
F9302-LTR4-TNT-insertion-3
[»] chr7 (5 HSPs)
chr7 (7-585)||(31200604-31201182)
chr7 (427-516)||(39051324-39051413)
chr7 (310-393)||(31293970-31294053)
chr7 (314-392)||(42629110-42629190)
chr7 (426-477)||(285651-285702)
[»] chr5 (9 HSPs)
chr5 (314-387)||(17193510-17193583)
chr5 (426-509)||(10353940-10354023)
chr5 (426-491)||(33900041-33900106)
chr5 (427-515)||(29638812-29638900)
chr5 (306-350)||(30329205-30329249)
chr5 (443-490)||(1623346-1623393)
chr5 (427-490)||(38475912-38475975)
chr5 (427-456)||(1436911-1436940)
chr5 (314-363)||(15007004-15007053)
[»] scaffold0010 (1 HSPs)
scaffold0010 (427-521)||(250355-250449)
[»] chr8 (5 HSPs)
chr8 (427-516)||(3694151-3694240)
chr8 (314-350)||(35700321-35700357)
chr8 (427-521)||(14294362-14294457)
chr8 (342-377)||(26998195-26998230)
chr8 (313-350)||(33996167-33996204)
[»] scaffold0018 (2 HSPs)
scaffold0018 (308-392)||(38858-38942)
scaffold0018 (426-521)||(38677-38770)
[»] chr4 (4 HSPs)
chr4 (427-515)||(19141972-19142060)
chr4 (427-515)||(41500069-41500157)
chr4 (427-521)||(43405533-43405627)
chr4 (314-378)||(28523839-28523903)
[»] chr3 (8 HSPs)
chr3 (427-515)||(675658-675746)
chr3 (426-521)||(27836735-27836828)
chr3 (314-392)||(27836915-27836993)
chr3 (314-368)||(35765025-35765079)
chr3 (314-368)||(46764190-46764244)
chr3 (317-350)||(48022244-48022277)
chr3 (314-350)||(10440787-10440823)
chr3 (314-386)||(34008778-34008850)
[»] chr1 (9 HSPs)
chr1 (427-515)||(4816197-4816285)
chr1 (313-368)||(43591147-43591202)
chr1 (427-501)||(22581709-22581783)
chr1 (317-387)||(41003111-41003181)
chr1 (426-578)||(8265646-8265795)
chr1 (314-350)||(32864396-32864432)
chr1 (427-515)||(34059766-34059854)
chr1 (462-515)||(10069247-10069300)
chr1 (426-462)||(12371580-12371616)
[»] chr6 (1 HSPs)
chr6 (325-387)||(6863400-6863462)
[»] chr2 (4 HSPs)
chr2 (426-524)||(40142214-40142312)
chr2 (315-383)||(3921869-3921938)
chr2 (314-363)||(27910020-27910069)
chr2 (313-377)||(2869033-2869097)
[»] scaffold0003 (1 HSPs)
scaffold0003 (317-362)||(418429-418474)


Alignment Details
Target: chr7 (Bit Score: 575; Significance: 0; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 575; E-Value: 0
Query Start/End: Original strand, 7 - 585
Target Start/End: Complemental strand, 31201182 - 31200604
Alignment:
7 agtaggatccccggacacaggtgaaaattgacatttatatgaccacagatctcatcctatcatgattttggtttgcacttgataacaaattaattacatt 106  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31201182 agtaggatctccggacacaggtgaaaattgacatttatatgaccacagatctcatcctatcatgattttggtttgcacttgataacaaattaattacatt 31201083  T
107 gtcattatagtatgatatcatatggtatttgagatgatgcacgaaaaaacgggccttgtttgttatcattgccttggaacaaaaagggtgtagaattact 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31201082 gtcattatagtatgatatcatatggtatttgagatgatgcacgaaaaaacgggccttgtttgttatcattgccttggaacaaaaagggtgtagaattact 31200983  T
207 atttgctacgggttcaagaaaggacatgtgaaaaatagatggagggtcataattcataagcatgggaacattttctgttttgaactaattaattgagtgg 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31200982 atttgctacgggttcaagaaaggacatgtgaaaaatagatggagggtcataattcataagcatgggaacattttctgttttgaactaattaattgagtgg 31200883  T
307 gtgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaaattacatttactt 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31200882 gtgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaaattacatttactt 31200783  T
407 aatttacattgtactaaaatgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccattta 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31200782 aatttacattgtactaaaatgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccattta 31200683  T
507 tcttccatttcattatgcgttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtgacaattg 585  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31200682 tcttccatttcattatgcgttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtgacaattg 31200604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 516
Target Start/End: Original strand, 39051324 - 39051413
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccattt 516  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||||||| ||| ||||||||||| |||| ||||||    
39051324 gttgaataatcaactcatcatcaatcttgtccgccacatctctctcaatataagtcacaagataatcattcatccattcatctcccattt 39051413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31294053 - 31293970
Alignment:
310 tacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaa 393  Q
    |||||| |||||||||||||||||||   |||||||||||| | |||| | | | |||||||||||||| ||||||| ||||||    
31294053 tacccaatggcgttgccaggaccctgggtcagggggttcaaacctttgtaatataattaataattataataatatattcaaaaa 31293970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 314 - 392
Target Start/End: Complemental strand, 42629190 - 42629110
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttga--ttaataattataacaatatatacaaaa 392  Q
    ||||||||||||||||||| | |  |||||||||||| |||||||| ||| |  ||||||||||||| |||||||| ||||    
42629190 cagtggcgttgccaggaccttaaggcagggggttcaaacttttgaattttaattttaataattataataatatatataaaa 42629110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 477
Target Start/End: Original strand, 285651 - 285702
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatat 477  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||    
285651 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat 285702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 314 - 387
Target Start/End: Original strand, 17193510 - 17193583
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||||||| ||||||||  | |||||||||||| ||||||| |||| |||||||||||||| ||||||||    
17193510 cagtggcgttgctaggaccctagatcagggggttcaaacttttgacctttaattaataattataataatatata 17193583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 426 - 509
Target Start/End: Complemental strand, 10354023 - 10353940
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatct 509  Q
    |||||||| |||| ||||||||||||||||| ||||| |||| | | |||||||| ||| ||||||| ||||||||||| ||||    
10354023 tgttgaatgatcacctcattatcaatgttgttgaacacatctttctcaatataagccactagacaatcattcatccattcatct 10353940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 426 - 491
Target Start/End: Complemental strand, 33900106 - 33900041
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaa 491  Q
    |||||||||||||||||||||||||||||| || | | ||||| ||||||||||  ||||||||||    
33900106 tgttgaataatcaactcattatcaatgttgccggatagatctcgtttaatataaaccacaagacaa 33900041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 29638900 - 29638812
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | ||||||||| || ||||||| ||||||||| | |||| |||||    
29638900 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtgacgagacaatcattcatccaatcatctcccatt 29638812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 306 - 350
Target Start/End: Complemental strand, 30329249 - 30329205
Alignment:
306 ggtgtacccagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||| ||||| ||||||||||||||||||| ||||||||||||||    
30329249 ggtgaacccactggcgttgccaggaccctggaccagggggttcaa 30329205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Original strand, 1623346 - 1623393
Alignment:
443 attatcaatgttgtcgaacatatctcttttaatataagtcacaagaca 490  Q
    ||||||||||||||||||||||||| || |||||||| |||| |||||    
1623346 attatcaatgttgtcgaacatatcttttctaatataaatcaccagaca 1623393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 490
Target Start/End: Complemental strand, 38475975 - 38475912
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagaca 490  Q
    ||||||||||||||||||||||||  || | ||||| |||||| | ||| ||||||||||||||    
38475975 gttgaataatcaactcattatcaacctttttgaacacatctctctcaatgtaagtcacaagaca 38475912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 456
Target Start/End: Original strand, 1436911 - 1436940
Alignment:
427 gttgaataatcaactcattatcaatgttgt 456  Q
    ||||||||||||||||||||||||||||||    
1436911 gttgaataatcaactcattatcaatgttgt 1436940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 363
Target Start/End: Original strand, 15007004 - 15007053
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaacttt 363  Q
    |||| |||||||||||||||| || |||||||||||| | ||||||||||    
15007004 cagtagcgttgccaggaccctaaagcagggggttcaaacctttgaacttt 15007053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 521
Target Start/End: Original strand, 250355 - 250449
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||| ||||    
250355 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatttgatta 250449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000004; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 427 - 516
Target Start/End: Original strand, 3694151 - 3694240
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccattt 516  Q
    ||||||||||||| ||||  ||||| |||||   || |||||| | |||||||||||||||||||| ||||||||||| |||| ||||||    
3694151 gttgaataatcaattcatcgtcaatcttgtccgccacatctctctcaatataagtcacaagacaatcattcatccattcatctcccattt 3694240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 314 - 350
Target Start/End: Original strand, 35700321 - 35700357
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||||||||||||||||||||| ||||||||||||||    
35700321 cagtggcgttgccaggaccctggaccagggggttcaa 35700357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 521
Target Start/End: Complemental strand, 14294457 - 14294362
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaat-aattcatccatttatcttccatttcatta 521  Q
    ||||||||||| | | |||||||||| ||||||||| |||||| ||||||||| | || ||| ||| | |||||||||||||| || |||| ||||    
14294457 gttgaataatccattaattatcaatggtgtcgaacacatctctcttaatataacttacgagagaatcagttcatccatttatcctcaatttgatta 14294362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 377
Target Start/End: Complemental strand, 26998230 - 26998195
Alignment:
342 ggggttcaatcttttgaactttgattaataattata 377  Q
    ||||||||| ||||||||||||||||||||||||||    
26998230 ggggttcaaacttttgaactttgattaataattata 26998195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 350
Target Start/End: Complemental strand, 33996204 - 33996167
Alignment:
313 ccagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||| ||||||||| ||||||||||||||    
33996204 ccagtggcgttgctaggaccctggaccagggggttcaa 33996167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 392
Target Start/End: Complemental strand, 38942 - 38858
Alignment:
308 tgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaa 392  Q
    |||| ||| |||||||||||||||||||    |||||||||||  |||  |||||| |||||||||||||| |||||||||||||    
38942 tgtaaccaatggcgttgccaggaccctgggttagggggttcaaaatttaaaactttaattaataattataataatatatacaaaa 38858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 426 - 521
Target Start/End: Complemental strand, 38770 - 38677
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||  ||||| |||||||  ||| || ||| ||||||| ||| ||||    
38770 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat--gtcacgagacaatcgttcgtcaattcatcttccttttgatta 38677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 19142060 - 19141972
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
19142060 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 19141972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Original strand, 41500069 - 41500157
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
41500069 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 41500157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 521
Target Start/End: Complemental strand, 43405627 - 43405533
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||||||||||||||| |||||| ||||||  ||||||||| | ||||||||| ||  |||||| |||||| || | |||| |||||| ||||    
43405627 gttgaataatcaactcatcatcaattttgtcggccatatctctctcaatataagttacgggacaatcattcatgcaatcatctcccattttatta 43405533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 378
Target Start/End: Complemental strand, 28523903 - 28523839
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataa 378  Q
    |||||||||||||||||||||     ||||||||||| |||| ||||||| || |||||||||||    
28523903 cagtggcgttgccaggaccctaggttagggggttcaacctttggaactttaatcaataattataa 28523839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Original strand, 675658 - 675746
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
675658 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 675746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 426 - 521
Target Start/End: Complemental strand, 27836828 - 27836735
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||  ||||| |||||||  ||| || ||| ||||||| ||| ||||    
27836828 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat--gtcacgagacaatcgttcgtcaattcatcttccttttgatta 27836735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 392
Target Start/End: Complemental strand, 27836993 - 27836915
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaa 392  Q
    ||||||||||| |||||| |||    |||||||||||  |||  |||||| |||||||||||||| |||||||||||||    
27836993 cagtggcgttgtcaggactctggggtagggggttcaaaatttaaaactttaattaataattataataatatatacaaaa 27836915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 368
Target Start/End: Complemental strand, 35765079 - 35765025
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    |||||||||||||||||||| ||  ||| |||||||| |||||||||||| ||||    
35765079 cagtggcgttgccaggaccccgagtcagcgggttcaaacttttgaactttaatta 35765025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 368
Target Start/End: Complemental strand, 46764244 - 46764190
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    |||||||||||||||||||| ||  ||| |||||||| |||||||||||| ||||    
46764244 cagtggcgttgccaggaccccgagtcagcgggttcaaacttttgaactttaatta 46764190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 317 - 350
Target Start/End: Original strand, 48022244 - 48022277
Alignment:
317 tggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||||||||| ||||||||||||||    
48022244 tggcgttgccaggaccctggaccagggggttcaa 48022277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 350
Target Start/End: Complemental strand, 10440823 - 10440787
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||||||| |||| ||||||||||||||    
10440823 cagtggcgttgccaggatcctggaccagggggttcaa 10440787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 386
Target Start/End: Original strand, 34008778 - 34008850
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatat 386  Q
    ||||||||||| ||||||||||   |||||||||||| | |||| | | | |||||||||||||| |||||||    
34008778 cagtggcgttgtcaggaccctgggtcagggggttcaaacctttgtaatataattaataattataataatatat 34008850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 4816285 - 4816197
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
4816285 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 4816197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 313 - 368
Target Start/End: Complemental strand, 43591202 - 43591147
Alignment:
313 ccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    ||||||||||||||||||||| ||| ||| |||||||| |||||||||||| ||||    
43591202 ccagtggcgttgccaggaccccgaatcagcgggttcaaacttttgaactttaatta 43591147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 501
Target Start/End: Complemental strand, 22581783 - 22581709
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatcc 501  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||    
22581783 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatcc 22581709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 317 - 387
Target Start/End: Original strand, 41003111 - 41003181
Alignment:
317 tggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||||||||| |||||| ||| ||||||||  ||||||| ||| |||||||| ||||| ||||||||    
41003111 tggcgttgccaggatcctgaatcagagggttcaaaattttgaattttaattaataactataataatatata 41003181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 426 - 578
Target Start/End: Original strand, 8265646 - 8265795
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcattatgcg 525  Q
    ||||||| |||||||  ||||||||| ||||| || || |||||   |||||||||||||||||||| |||||| |||| ||||| ||||| ||||  |     
8265646 tgttgaacaatcaacctattatcaatattgtctaatatgtctctc--aatataagtcacaagacaatcattcattcattcatctt-catttgattacaca 8265742  T
526 ttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtg 578  Q
     | || | |||||||||| ||||||| |||| || ||||  ||||||||||||    
8265743 atctagttttcacaaccttcatagcataaaaggaccgtttgacagttgttgtg 8265795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 314 - 350
Target Start/End: Complemental strand, 32864432 - 32864396
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||||||||||||||||||||| ||||||||||||||    
32864432 cagtggcgttgccaggaccctggaccagggggttcaa 32864396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 34059854 - 34059766
Alignment:
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | ||||||||| || ||||||| ||||||||| | |||| |||||    
34059854 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagttacgagacaatcattcatccaatcatctcccatt 34059766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 462 - 515
Target Start/End: Complemental strand, 10069300 - 10069247
Alignment:
462 atatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    ||||| |||| |||||||||||| ||||||| ||||||||||| ||| ||||||    
10069300 atatccctttcaatataagtcactagacaatcattcatccattcatcctccatt 10069247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 426 - 462
Target Start/End: Original strand, 12371580 - 12371616
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaaca 462  Q
    ||||||||||||||||||| |||||||||| ||||||    
12371580 tgttgaataatcaactcatcatcaatgttgccgaaca 12371616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 325 - 387
Target Start/End: Complemental strand, 6863462 - 6863400
Alignment:
325 ccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||| |||  || ||||||||| ||||| ||||||||||||||||||||  ||||||||    
6863462 ccaggaccttgagtcacggggttcaaacttttaaactttgattaataattatagtaatatata 6863400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 524
Target Start/End: Complemental strand, 40142312 - 40142214
Alignment:
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcattatgc 524  Q
    ||||||||||||||||||  |||||||||||| |||| |   || | |||||||||||  |||||||  |||||||| | |||| |||||| |||||||    
40142312 tgttgaataatcaactcacgatcaatgttgtctaacacactcctctcaatataagtcatgagacaatcgttcatccactcatctcccatttgattatgc 40142214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 315 - 383
Target Start/End: Original strand, 3921869 - 3921938
Alignment:
315 agtggcgttgccaggaccctgaacca-gggggttcaatcttttgaactttgattaataattataacaata 383  Q
    ||||||||||||||||||||| | || |||||||||| ||||||| | || |||||||||| ||| ||||    
3921869 agtggcgttgccaggaccctggatcaggggggttcaaacttttgatccttaattaataattgtaataata 3921938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 363
Target Start/End: Original strand, 27910020 - 27910069
Alignment:
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaacttt 363  Q
    |||||||||||||||||||||  | |||||||||||| | ||||||||||    
27910020 cagtggcgttgccaggaccctagagcagggggttcaaacctttgaacttt 27910069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 313 - 377
Target Start/End: Complemental strand, 2869097 - 2869033
Alignment:
313 ccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattata 377  Q
    |||||||||||||||||| ||||   |||||| |  ||| ||||||||||| |||||||||||||    
2869097 ccagtggcgttgccaggaacctgtgtcaggggttcaaattttttgaactttaattaataattata 2869033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 418474 - 418429
Alignment:
317 tggcgttgccaggaccctgaaccagggggttcaatcttttgaactt 362  Q
    ||||||||||||||||||| | |||||||||||| ||||| |||||    
418474 tggcgttgccaggaccctggatcagggggttcaaacttttaaactt 418429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC