View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9302-LTR4-TNT-insertion-3 (Length: 594)

Name: F9302-LTR4-TNT-insertion-3
Description: F9302-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9302-LTR4-TNT-insertion-3
[»] chr7 (5 HSPs)
chr7 (7-585)||(31200604-31201182)
chr7 (427-516)||(39051324-39051413)
chr7 (310-393)||(31293970-31294053)
chr7 (314-392)||(42629110-42629190)
chr7 (426-477)||(285651-285702)
[»] chr5 (9 HSPs)
chr5 (314-387)||(17193510-17193583)
chr5 (426-509)||(10353940-10354023)
chr5 (426-491)||(33900041-33900106)
chr5 (427-515)||(29638812-29638900)
chr5 (306-350)||(30329205-30329249)
chr5 (443-490)||(1623346-1623393)
chr5 (427-490)||(38475912-38475975)
chr5 (427-456)||(1436911-1436940)
chr5 (314-363)||(15007004-15007053)
[»] scaffold0010 (1 HSPs)
scaffold0010 (427-521)||(250355-250449)
[»] chr8 (5 HSPs)
chr8 (427-516)||(3694151-3694240)
chr8 (314-350)||(35700321-35700357)
chr8 (427-521)||(14294362-14294457)
chr8 (342-377)||(26998195-26998230)
chr8 (313-350)||(33996167-33996204)
[»] scaffold0018 (2 HSPs)
scaffold0018 (308-392)||(38858-38942)
scaffold0018 (426-521)||(38677-38770)
[»] chr4 (4 HSPs)
chr4 (427-515)||(19141972-19142060)
chr4 (427-515)||(41500069-41500157)
chr4 (427-521)||(43405533-43405627)
chr4 (314-378)||(28523839-28523903)
[»] chr3 (8 HSPs)
chr3 (427-515)||(675658-675746)
chr3 (426-521)||(27836735-27836828)
chr3 (314-392)||(27836915-27836993)
chr3 (314-368)||(35765025-35765079)
chr3 (314-368)||(46764190-46764244)
chr3 (317-350)||(48022244-48022277)
chr3 (314-350)||(10440787-10440823)
chr3 (314-386)||(34008778-34008850)
[»] chr1 (9 HSPs)
chr1 (427-515)||(4816197-4816285)
chr1 (313-368)||(43591147-43591202)
chr1 (427-501)||(22581709-22581783)
chr1 (317-387)||(41003111-41003181)
chr1 (426-578)||(8265646-8265795)
chr1 (314-350)||(32864396-32864432)
chr1 (427-515)||(34059766-34059854)
chr1 (462-515)||(10069247-10069300)
chr1 (426-462)||(12371580-12371616)
[»] chr6 (1 HSPs)
chr6 (325-387)||(6863400-6863462)
[»] chr2 (4 HSPs)
chr2 (426-524)||(40142214-40142312)
chr2 (315-383)||(3921869-3921938)
chr2 (314-363)||(27910020-27910069)
chr2 (313-377)||(2869033-2869097)
[»] scaffold0003 (1 HSPs)
scaffold0003 (317-362)||(418429-418474)

Alignment Details
Target: chr7 (Bit Score: 575; Significance: 0; HSPs: 5)
Name: chr7

Target: chr7; HSP #1
Raw Score: 575; E-Value: 0
Query Start/End: Original strand, 7 - 585
Target Start/End: Complemental strand, 31201182 - 31200604
7 agtaggatccccggacacaggtgaaaattgacatttatatgaccacagatctcatcctatcatgattttggtttgcacttgataacaaattaattacatt 106  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31201182 agtaggatctccggacacaggtgaaaattgacatttatatgaccacagatctcatcctatcatgattttggtttgcacttgataacaaattaattacatt 31201083  T
107 gtcattatagtatgatatcatatggtatttgagatgatgcacgaaaaaacgggccttgtttgttatcattgccttggaacaaaaagggtgtagaattact 206  Q
31201082 gtcattatagtatgatatcatatggtatttgagatgatgcacgaaaaaacgggccttgtttgttatcattgccttggaacaaaaagggtgtagaattact 31200983  T
207 atttgctacgggttcaagaaaggacatgtgaaaaatagatggagggtcataattcataagcatgggaacattttctgttttgaactaattaattgagtgg 306  Q
31200982 atttgctacgggttcaagaaaggacatgtgaaaaatagatggagggtcataattcataagcatgggaacattttctgttttgaactaattaattgagtgg 31200883  T
307 gtgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaaattacatttactt 406  Q
31200882 gtgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaaattacatttactt 31200783  T
407 aatttacattgtactaaaatgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccattta 506  Q
31200782 aatttacattgtactaaaatgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccattta 31200683  T
507 tcttccatttcattatgcgttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtgacaattg 585  Q
31200682 tcttccatttcattatgcgttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtgacaattg 31200604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 427 - 516
Target Start/End: Original strand, 39051324 - 39051413
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccattt 516  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||||||| ||| ||||||||||| |||| ||||||    
39051324 gttgaataatcaactcatcatcaatcttgtccgccacatctctctcaatataagtcacaagataatcattcatccattcatctcccattt 39051413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31294053 - 31293970
310 tacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaaa 393  Q
    |||||| |||||||||||||||||||   |||||||||||| | |||| | | | |||||||||||||| ||||||| ||||||    
31294053 tacccaatggcgttgccaggaccctgggtcagggggttcaaacctttgtaatataattaataattataataatatattcaaaaa 31293970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 314 - 392
Target Start/End: Complemental strand, 42629190 - 42629110
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttga--ttaataattataacaatatatacaaaa 392  Q
    ||||||||||||||||||| | |  |||||||||||| |||||||| ||| |  ||||||||||||| |||||||| ||||    
42629190 cagtggcgttgccaggaccttaaggcagggggttcaaacttttgaattttaattttaataattataataatatatataaaa 42629110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 477
Target Start/End: Original strand, 285651 - 285702
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatat 477  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||    
285651 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat 285702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 9)
Name: chr5

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 314 - 387
Target Start/End: Original strand, 17193510 - 17193583
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||||||| ||||||||  | |||||||||||| ||||||| |||| |||||||||||||| ||||||||    
17193510 cagtggcgttgctaggaccctagatcagggggttcaaacttttgacctttaattaataattataataatatata 17193583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 426 - 509
Target Start/End: Complemental strand, 10354023 - 10353940
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatct 509  Q
    |||||||| |||| ||||||||||||||||| ||||| |||| | | |||||||| ||| ||||||| ||||||||||| ||||    
10354023 tgttgaatgatcacctcattatcaatgttgttgaacacatctttctcaatataagccactagacaatcattcatccattcatct 10353940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 426 - 491
Target Start/End: Complemental strand, 33900106 - 33900041
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaa 491  Q
    |||||||||||||||||||||||||||||| || | | ||||| ||||||||||  ||||||||||    
33900106 tgttgaataatcaactcattatcaatgttgccggatagatctcgtttaatataaaccacaagacaa 33900041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 29638900 - 29638812
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | ||||||||| || ||||||| ||||||||| | |||| |||||    
29638900 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtgacgagacaatcattcatccaatcatctcccatt 29638812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 306 - 350
Target Start/End: Complemental strand, 30329249 - 30329205
306 ggtgtacccagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||| ||||| ||||||||||||||||||| ||||||||||||||    
30329249 ggtgaacccactggcgttgccaggaccctggaccagggggttcaa 30329205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 490
Target Start/End: Original strand, 1623346 - 1623393
443 attatcaatgttgtcgaacatatctcttttaatataagtcacaagaca 490  Q
    ||||||||||||||||||||||||| || |||||||| |||| |||||    
1623346 attatcaatgttgtcgaacatatcttttctaatataaatcaccagaca 1623393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 490
Target Start/End: Complemental strand, 38475975 - 38475912
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagaca 490  Q
    ||||||||||||||||||||||||  || | ||||| |||||| | ||| ||||||||||||||    
38475975 gttgaataatcaactcattatcaacctttttgaacacatctctctcaatgtaagtcacaagaca 38475912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 456
Target Start/End: Original strand, 1436911 - 1436940
427 gttgaataatcaactcattatcaatgttgt 456  Q
1436911 gttgaataatcaactcattatcaatgttgt 1436940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 363
Target Start/End: Original strand, 15007004 - 15007053
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaacttt 363  Q
    |||| |||||||||||||||| || |||||||||||| | ||||||||||    
15007004 cagtagcgttgccaggaccctaaagcagggggttcaaacctttgaacttt 15007053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0010

Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 427 - 521
Target Start/End: Original strand, 250355 - 250449
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||| ||||    
250355 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatttgatta 250449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000004; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 427 - 516
Target Start/End: Original strand, 3694151 - 3694240
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccattt 516  Q
    ||||||||||||| ||||  ||||| |||||   || |||||| | |||||||||||||||||||| ||||||||||| |||| ||||||    
3694151 gttgaataatcaattcatcgtcaatcttgtccgccacatctctctcaatataagtcacaagacaatcattcatccattcatctcccattt 3694240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 314 - 350
Target Start/End: Original strand, 35700321 - 35700357
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||||||||||||||||||||| ||||||||||||||    
35700321 cagtggcgttgccaggaccctggaccagggggttcaa 35700357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 521
Target Start/End: Complemental strand, 14294457 - 14294362
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaat-aattcatccatttatcttccatttcatta 521  Q
    ||||||||||| | | |||||||||| ||||||||| |||||| ||||||||| | || ||| ||| | |||||||||||||| || |||| ||||    
14294457 gttgaataatccattaattatcaatggtgtcgaacacatctctcttaatataacttacgagagaatcagttcatccatttatcctcaatttgatta 14294362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 377
Target Start/End: Complemental strand, 26998230 - 26998195
342 ggggttcaatcttttgaactttgattaataattata 377  Q
    ||||||||| ||||||||||||||||||||||||||    
26998230 ggggttcaaacttttgaactttgattaataattata 26998195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 350
Target Start/End: Complemental strand, 33996204 - 33996167
313 ccagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||| ||||||||| ||||||||||||||    
33996204 ccagtggcgttgctaggaccctggaccagggggttcaa 33996167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0018

Target: scaffold0018; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 392
Target Start/End: Complemental strand, 38942 - 38858
308 tgtacccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaa 392  Q
    |||| ||| |||||||||||||||||||    |||||||||||  |||  |||||| |||||||||||||| |||||||||||||    
38942 tgtaaccaatggcgttgccaggaccctgggttagggggttcaaaatttaaaactttaattaataattataataatatatacaaaa 38858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 426 - 521
Target Start/End: Complemental strand, 38770 - 38677
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||  ||||| |||||||  ||| || ||| ||||||| ||| ||||    
38770 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat--gtcacgagacaatcgttcgtcaattcatcttccttttgatta 38677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr4

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 19142060 - 19141972
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
19142060 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 19141972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Original strand, 41500069 - 41500157
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
41500069 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 41500157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 521
Target Start/End: Complemental strand, 43405627 - 43405533
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||||||||||||||| |||||| ||||||  ||||||||| | ||||||||| ||  |||||| |||||| || | |||| |||||| ||||    
43405627 gttgaataatcaactcatcatcaattttgtcggccatatctctctcaatataagttacgggacaatcattcatgcaatcatctcccattttatta 43405533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 378
Target Start/End: Complemental strand, 28523903 - 28523839
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataa 378  Q
    |||||||||||||||||||||     ||||||||||| |||| ||||||| || |||||||||||    
28523903 cagtggcgttgccaggaccctaggttagggggttcaacctttggaactttaatcaataattataa 28523839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 8)
Name: chr3

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Original strand, 675658 - 675746
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
675658 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 675746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 426 - 521
Target Start/End: Complemental strand, 27836828 - 27836735
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcatta 521  Q
    |||||| |||| ||||| ||||||||||||||||| |||||||||| |||||  ||||| |||||||  ||| || ||| ||||||| ||| ||||    
27836828 tgttgagtaataaactctttatcaatgttgtcgaatatatctctttcaatat--gtcacgagacaatcgttcgtcaattcatcttccttttgatta 27836735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 392
Target Start/End: Complemental strand, 27836993 - 27836915
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatatacaaaa 392  Q
    ||||||||||| |||||| |||    |||||||||||  |||  |||||| |||||||||||||| |||||||||||||    
27836993 cagtggcgttgtcaggactctggggtagggggttcaaaatttaaaactttaattaataattataataatatatacaaaa 27836915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 368
Target Start/End: Complemental strand, 35765079 - 35765025
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    |||||||||||||||||||| ||  ||| |||||||| |||||||||||| ||||    
35765079 cagtggcgttgccaggaccccgagtcagcgggttcaaacttttgaactttaatta 35765025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 314 - 368
Target Start/End: Complemental strand, 46764244 - 46764190
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    |||||||||||||||||||| ||  ||| |||||||| |||||||||||| ||||    
46764244 cagtggcgttgccaggaccccgagtcagcgggttcaaacttttgaactttaatta 46764190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 317 - 350
Target Start/End: Original strand, 48022244 - 48022277
317 tggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||||||||| ||||||||||||||    
48022244 tggcgttgccaggaccctggaccagggggttcaa 48022277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 350
Target Start/End: Complemental strand, 10440823 - 10440787
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    ||||||||||||||||| |||| ||||||||||||||    
10440823 cagtggcgttgccaggatcctggaccagggggttcaa 10440787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 314 - 386
Target Start/End: Original strand, 34008778 - 34008850
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatat 386  Q
    ||||||||||| ||||||||||   |||||||||||| | |||| | | | |||||||||||||| |||||||    
34008778 cagtggcgttgtcaggaccctgggtcagggggttcaaacctttgtaatataattaataattataataatatat 34008850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 9)
Name: chr1

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 4816285 - 4816197
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||| | |||| |||||    
4816285 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatccaatcatctcccatt 4816197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 313 - 368
Target Start/End: Complemental strand, 43591202 - 43591147
313 ccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgatta 368  Q
    ||||||||||||||||||||| ||| ||| |||||||| |||||||||||| ||||    
43591202 ccagtggcgttgccaggaccccgaatcagcgggttcaaacttttgaactttaatta 43591147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 427 - 501
Target Start/End: Complemental strand, 22581783 - 22581709
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatcc 501  Q
    |||||||||||||||||| |||||| |||||   || |||||| | |||||||||||| ||||||| ||||||||    
22581783 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagtcacgagacaatcattcatcc 22581709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 317 - 387
Target Start/End: Original strand, 41003111 - 41003181
317 tggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||||||||| |||||| ||| ||||||||  ||||||| ||| |||||||| ||||| ||||||||    
41003111 tggcgttgccaggatcctgaatcagagggttcaaaattttgaattttaattaataactataataatatata 41003181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 426 - 578
Target Start/End: Original strand, 8265646 - 8265795
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcattatgcg 525  Q
    ||||||| |||||||  ||||||||| ||||| || || |||||   |||||||||||||||||||| |||||| |||| ||||| ||||| ||||  |     
8265646 tgttgaacaatcaacctattatcaatattgtctaatatgtctctc--aatataagtcacaagacaatcattcattcattcatctt-catttgattacaca 8265742  T
526 ttatattgttcacaacctccatagcaaaaaatgatcgttaaacagttgttgtg 578  Q
     | || | |||||||||| ||||||| |||| || ||||  ||||||||||||    
8265743 atctagttttcacaaccttcatagcataaaaggaccgtttgacagttgttgtg 8265795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 314 - 350
Target Start/End: Complemental strand, 32864432 - 32864396
314 cagtggcgttgccaggaccctgaaccagggggttcaa 350  Q
    |||||||||||||||||||||| ||||||||||||||    
32864432 cagtggcgttgccaggaccctggaccagggggttcaa 32864396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 515
Target Start/End: Complemental strand, 34059854 - 34059766
427 gttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    |||||||||||||||||| |||||| |||||   || |||||| | ||||||||| || ||||||| ||||||||| | |||| |||||    
34059854 gttgaataatcaactcatcatcaattttgtccgccacatctctctcaatataagttacgagacaatcattcatccaatcatctcccatt 34059766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 462 - 515
Target Start/End: Complemental strand, 10069300 - 10069247
462 atatctcttttaatataagtcacaagacaataattcatccatttatcttccatt 515  Q
    ||||| |||| |||||||||||| ||||||| ||||||||||| ||| ||||||    
10069300 atatccctttcaatataagtcactagacaatcattcatccattcatcctccatt 10069247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 426 - 462
Target Start/End: Original strand, 12371580 - 12371616
426 tgttgaataatcaactcattatcaatgttgtcgaaca 462  Q
    ||||||||||||||||||| |||||||||| ||||||    
12371580 tgttgaataatcaactcatcatcaatgttgccgaaca 12371616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 325 - 387
Target Start/End: Complemental strand, 6863462 - 6863400
325 ccaggaccctgaaccagggggttcaatcttttgaactttgattaataattataacaatatata 387  Q
    |||||||| |||  || ||||||||| ||||| ||||||||||||||||||||  ||||||||    
6863462 ccaggaccttgagtcacggggttcaaacttttaaactttgattaataattatagtaatatata 6863400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 4)
Name: chr2

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 426 - 524
Target Start/End: Complemental strand, 40142312 - 40142214
426 tgttgaataatcaactcattatcaatgttgtcgaacatatctcttttaatataagtcacaagacaataattcatccatttatcttccatttcattatgc 524  Q
    ||||||||||||||||||  |||||||||||| |||| |   || | |||||||||||  |||||||  |||||||| | |||| |||||| |||||||    
40142312 tgttgaataatcaactcacgatcaatgttgtctaacacactcctctcaatataagtcatgagacaatcgttcatccactcatctcccatttgattatgc 40142214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 315 - 383
Target Start/End: Original strand, 3921869 - 3921938
315 agtggcgttgccaggaccctgaacca-gggggttcaatcttttgaactttgattaataattataacaata 383  Q
    ||||||||||||||||||||| | || |||||||||| ||||||| | || |||||||||| ||| ||||    
3921869 agtggcgttgccaggaccctggatcaggggggttcaaacttttgatccttaattaataattgtaataata 3921938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 363
Target Start/End: Original strand, 27910020 - 27910069
314 cagtggcgttgccaggaccctgaaccagggggttcaatcttttgaacttt 363  Q
    |||||||||||||||||||||  | |||||||||||| | ||||||||||    
27910020 cagtggcgttgccaggaccctagagcagggggttcaaacctttgaacttt 27910069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 313 - 377
Target Start/End: Complemental strand, 2869097 - 2869033
313 ccagtggcgttgccaggaccctgaaccagggggttcaatcttttgaactttgattaataattata 377  Q
    |||||||||||||||||| ||||   |||||| |  ||| ||||||||||| |||||||||||||    
2869097 ccagtggcgttgccaggaacctgtgtcaggggttcaaattttttgaactttaattaataattata 2869033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0003

Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 418474 - 418429
317 tggcgttgccaggaccctgaaccagggggttcaatcttttgaactt 362  Q
    ||||||||||||||||||| | |||||||||||| ||||| |||||    
418474 tggcgttgccaggaccctggatcagggggttcaaacttttaaactt 418429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105537 times since January 2019
Visitors: 2328