View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-1 (Length: 384)

Name: F9303-LTR4-TNT-insertion-1
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-1
F9303-LTR4-TNT-insertion-1
[»] chr1 (1 HSPs)
chr1 (5-357)||(45206954-45207306)
[»] chr7 (1 HSPs)
chr7 (157-201)||(25296828-25296873)
[»] chr4 (1 HSPs)
chr4 (159-188)||(26400612-26400641)
[»] chr2 (1 HSPs)
chr2 (159-200)||(25517035-25517078)


Alignment Details
Target: chr1 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 5 - 357
Target Start/End: Complemental strand, 45207306 - 45206954
Alignment:
5 acatgagcataggttttgggatgaattatttacaagctttttcgataaagatctaagaccccccatatttaactctatccaatttagcctccgcaatacc 104  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45207306 acataagcataggttttgggatgaattatttacaagctttttcgataaagatctaagaccccccatatttaactctatccaatttagcctccgcaatacc 45207207  T
105 acttttttgtgttaactcaggagaaaggtccggagtttgtaagaaaagtttcgccaagaattgtttcaccaggaatcaaactcaagttatcctgaacact 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45207206 acttttttgtgttaactcaggagaaaggtccggagtttgtaagaaaagtttcgccaagaattgtttcaccaggaatcaaactcaagttatcctgaacact 45207107  T
205 aacaattcgtttttggtaaagcgtattaaccacttgagtccaattgcttggatggtgcaataaccctttaaaactactagtggtggtagtaaataataat 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
45207106 aacaattcgtttttggtaaagcgtattaaccacttgagtccaattgcttggatggtgcaatatccctttaaaactactagtggtggtagtaaataataat 45207007  T
305 gatctacagccaatctcaaaatattgaaatttgcaaacagttttcttagatta 357  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
45207006 gatctacagccaatctcaaaatattgaaatttgcaaacagttttcttagatta 45206954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 25296828 - 25296873
Alignment:
157 gccaagaattgtttcacc-aggaatcaaactcaagttatcctgaac 201  Q
    ||||||||||||| |||| |||||||||||||||||| ||||||||    
25296828 gccaagaattgttccaccgaggaatcaaactcaagttctcctgaac 25296873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 188
Target Start/End: Original strand, 26400612 - 26400641
Alignment:
159 caagaattgtttcaccaggaatcaaactca 188  Q
    ||||||||||||||||||||||||||||||    
26400612 caagaattgtttcaccaggaatcaaactca 26400641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 159 - 200
Target Start/End: Complemental strand, 25517078 - 25517035
Alignment:
159 caagaattgtttca--ccaggaatcaaactcaagttatcctgaa 200  Q
    ||||||||||||||  |||||||||||||||||||| |||||||    
25517078 caagaattgtttcaatccaggaatcaaactcaagttctcctgaa 25517035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95121 times since January 2019
Visitors: 2229