View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-3 (Length: 198)

Name: F9303-LTR4-TNT-insertion-3
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-3
F9303-LTR4-TNT-insertion-3
[»] chr8 (1 HSPs)
chr8 (8-188)||(35201510-35201690)


Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 35201690 - 35201510
Alignment:
8 gcacttacgagctatataaaaaatacaaatcacttccttacgaacatgctttataaacctctcattgatctcaattataaattcaaatattagatatgtg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
35201690 gcacttacgagctatataaaaaatacaaatcacttccttacgaacatgctttataaacctctcattgatctcaattatagattcaaatattagatatgtg 35201591  T
108 aatatatctcaattacgttcaattatagaaatttaaaaaggaatgaagggtgtagatgtctcacatgtataaagctcatta 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35201590 aatatatctcaattacgttcaattatagaaatttaaaaaggaatgaagggtgtagatgtctcacatgtataaagctcatta 35201510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93630 times since January 2019
Visitors: 2365