View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-5 (Length: 203)

Name: F9303-LTR4-TNT-insertion-5
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-5
F9303-LTR4-TNT-insertion-5
[»] chr3 (15 HSPs)
chr3 (10-193)||(26181306-26181489)
chr3 (20-117)||(26144010-26144104)
chr3 (12-61)||(26211143-26211192)
chr3 (12-61)||(26238386-26238435)
chr3 (13-74)||(26626859-26626920)
chr3 (14-65)||(27462885-27462936)
chr3 (14-68)||(28000272-28000326)
chr3 (129-174)||(26627095-26627140)
chr3 (135-175)||(26211086-26211126)
chr3 (135-175)||(26238329-26238369)
chr3 (14-74)||(28081118-28081178)
chr3 (14-74)||(28179275-28179335)
chr3 (14-68)||(27911235-27911289)
chr3 (14-68)||(28049382-28049436)
chr3 (21-66)||(28512059-28512104)
[»] scaffold0067 (1 HSPs)
scaffold0067 (20-64)||(24805-24852)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 15)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 26181489 - 26181306
Alignment:
10 gaaaattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26181489 gaaaattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagt 26181390  T
110 tagatagtggtgatttgataacaacaagatctatggacggtacaatagtcaaggtatccctctttccacatgtttgtgacatta 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26181389 tagatagtggtgatttgataacaacaagatctatggacggtacaatagtcaaggtatccctctttccacatgtttgtgacatta 26181306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 26144104 - 26144010
Alignment:
20 tgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagttagatagt 117  Q
    |||||||||||||||||||||||   ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||    
26144104 tgcaattggaatacatatttgga---tacaatcatgatcatcaaaaccatactgaaatggcaaaacttgaactcaatgaatgcccgcagttagctagt 26144010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 26211192 - 26211143
Alignment:
12 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
26211192 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 26211143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 26238435 - 26238386
Alignment:
12 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
26238435 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 26238386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 26626859 - 26626920
Alignment:
13 aattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||    
26626859 aattgtgtgcaattggaatacatatttgaacacgacattcatgatcatcaaaaccacactga 26626920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 27462936 - 27462885
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaa 65  Q
    |||||| | |||||||||||||| |||||||||||| |||||||||||||||    
27462936 attgtgagaaattggaatacatacttggacactacactcatgatcatcaaaa 27462885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 28000272 - 28000326
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| ||||||||| |||| ||||||||||||||||    
28000272 attgtgagaaattggaatacataattggacacttcaatgatgatcatcaaaacca 28000326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 174
Target Start/End: Original strand, 26627095 - 26627140
Alignment:
129 aacaacaagatctatggacggtacaatagtcaaggtatccctcttt 174  Q
    |||||||||||||||||||||||||||  | |||||||||||||||    
26627095 aacaacaagatctatggacggtacaatcataaaggtatccctcttt 26627140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 26211126 - 26211086
Alignment:
135 aagatctatggacggtacaatagtcaaggtatccctctttc 175  Q
    |||||||||||||||||||||  ||||||||||||||||||    
26211126 aagatctatggacggtacaatcatcaaggtatccctctttc 26211086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 26238369 - 26238329
Alignment:
135 aagatctatggacggtacaatagtcaaggtatccctctttc 175  Q
    |||||||||||||||||||||  ||||||||||||||||||    
26238369 aagatctatggacggtacaatcatcaaggtatccctctttc 26238329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 28081118 - 28081178
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||| |||| ||||||||||| ||||||| |||| | |||||||||||||||| |||||    
28081118 attgtgagcaactggaatacataattggacaatacactgatgatcatcaaaaccacactga 28081178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 28179275 - 28179335
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||| | |||||||||||||| ||||||||| || | |||||||||||||||| |||||    
28179275 attgtgagaaattggaatacataattggacacttcactgatgatcatcaaaaccacactga 28179335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 27911235 - 27911289
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| |||||||| ||| | ||||||||||||||||    
27911235 attgtgagaaattggaatacataattggacacgacactgatgatcatcaaaacca 27911289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 28049382 - 28049436
Alignment:
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| ||||||||| || | ||||||||||||||||    
28049382 attgtgagaaattggaatacataattggacacttcactgatgatcatcaaaacca 28049436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 28512104 - 28512059
Alignment:
21 gcaattggaatacatatttggacactacaatcatgatcatcaaaac 66  Q
    |||||||||||| ||| |||||||||||||  ||||||||||||||    
28512104 gcaattggaatatataattggacactacaacgatgatcatcaaaac 28512059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 24805 - 24852
Alignment:
20 tgcaattggaatacat---atttggacactacaatcatgatcatcaaa 64  Q
    ||||||||||||||||   |||||||||| ||||||||||||||||||    
24805 tgcaattggaatacatcatatttggacacgacaatcatgatcatcaaa 24852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC