View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-5 (Length: 203)

Name: F9303-LTR4-TNT-insertion-5
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9303-LTR4-TNT-insertion-5
[»] chr3 (15 HSPs)
chr3 (10-193)||(26181306-26181489)
chr3 (20-117)||(26144010-26144104)
chr3 (12-61)||(26211143-26211192)
chr3 (12-61)||(26238386-26238435)
chr3 (13-74)||(26626859-26626920)
chr3 (14-65)||(27462885-27462936)
chr3 (14-68)||(28000272-28000326)
chr3 (129-174)||(26627095-26627140)
chr3 (135-175)||(26211086-26211126)
chr3 (135-175)||(26238329-26238369)
chr3 (14-74)||(28081118-28081178)
chr3 (14-74)||(28179275-28179335)
chr3 (14-68)||(27911235-27911289)
chr3 (14-68)||(28049382-28049436)
chr3 (21-66)||(28512059-28512104)
[»] scaffold0067 (1 HSPs)
scaffold0067 (20-64)||(24805-24852)

Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 15)
Name: chr3

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 26181489 - 26181306
10 gaaaattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagt 109  Q
26181489 gaaaattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagt 26181390  T
110 tagatagtggtgatttgataacaacaagatctatggacggtacaatagtcaaggtatccctctttccacatgtttgtgacatta 193  Q
26181389 tagatagtggtgatttgataacaacaagatctatggacggtacaatagtcaaggtatccctctttccacatgtttgtgacatta 26181306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 26144104 - 26144010
20 tgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactgaaatggcaaaacttgaactcaatgaatgctcgcagttagatagt 117  Q
    |||||||||||||||||||||||   ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||    
26144104 tgcaattggaatacatatttgga---tacaatcatgatcatcaaaaccatactgaaatggcaaaacttgaactcaatgaatgcccgcagttagctagt 26144010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 26211192 - 26211143
12 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 61  Q
26211192 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 26211143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 26238435 - 26238386
12 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 61  Q
26238435 aaattgtgtgcaattggaatacatatttggacactacaatcatgatcatc 26238386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 26626859 - 26626920
13 aattgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||    
26626859 aattgtgtgcaattggaatacatatttgaacacgacattcatgatcatcaaaaccacactga 26626920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 27462936 - 27462885
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaa 65  Q
    |||||| | |||||||||||||| |||||||||||| |||||||||||||||    
27462936 attgtgagaaattggaatacatacttggacactacactcatgatcatcaaaa 27462885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 28000272 - 28000326
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| ||||||||| |||| ||||||||||||||||    
28000272 attgtgagaaattggaatacataattggacacttcaatgatgatcatcaaaacca 28000326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 174
Target Start/End: Original strand, 26627095 - 26627140
129 aacaacaagatctatggacggtacaatagtcaaggtatccctcttt 174  Q
    |||||||||||||||||||||||||||  | |||||||||||||||    
26627095 aacaacaagatctatggacggtacaatcataaaggtatccctcttt 26627140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 26211126 - 26211086
135 aagatctatggacggtacaatagtcaaggtatccctctttc 175  Q
    |||||||||||||||||||||  ||||||||||||||||||    
26211126 aagatctatggacggtacaatcatcaaggtatccctctttc 26211086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 26238369 - 26238329
135 aagatctatggacggtacaatagtcaaggtatccctctttc 175  Q
    |||||||||||||||||||||  ||||||||||||||||||    
26238369 aagatctatggacggtacaatcatcaaggtatccctctttc 26238329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 28081118 - 28081178
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||| |||| ||||||||||| ||||||| |||| | |||||||||||||||| |||||    
28081118 attgtgagcaactggaatacataattggacaatacactgatgatcatcaaaaccacactga 28081178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 28179275 - 28179335
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaaccagactga 74  Q
    |||||| | |||||||||||||| ||||||||| || | |||||||||||||||| |||||    
28179275 attgtgagaaattggaatacataattggacacttcactgatgatcatcaaaaccacactga 28179335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 27911235 - 27911289
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| |||||||| ||| | ||||||||||||||||    
27911235 attgtgagaaattggaatacataattggacacgacactgatgatcatcaaaacca 27911289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 28049382 - 28049436
14 attgtgtgcaattggaatacatatttggacactacaatcatgatcatcaaaacca 68  Q
    |||||| | |||||||||||||| ||||||||| || | ||||||||||||||||    
28049382 attgtgagaaattggaatacataattggacacttcactgatgatcatcaaaacca 28049436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 28512104 - 28512059
21 gcaattggaatacatatttggacactacaatcatgatcatcaaaac 66  Q
    |||||||||||| ||| |||||||||||||  ||||||||||||||    
28512104 gcaattggaatatataattggacactacaacgatgatcatcaaaac 28512059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0067

Target: scaffold0067; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 24805 - 24852
20 tgcaattggaatacat---atttggacactacaatcatgatcatcaaa 64  Q
    ||||||||||||||||   |||||||||| ||||||||||||||||||    
24805 tgcaattggaatacatcatatttggacacgacaatcatgatcatcaaa 24852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 93561 times since January 2019
Visitors: 2365