View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-6 (Length: 280)

Name: F9303-LTR4-TNT-insertion-6
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-6
F9303-LTR4-TNT-insertion-6
[»] chr4 (1 HSPs)
chr4 (11-271)||(34466765-34467025)


Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 34466765 - 34467025
Alignment:
11 tatcatccatgtgttgtgttatttttacttgttaattaataattgggttgagttgcagattgaatgaggatatgattgagtcactattcatggcaaataa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34466765 tatcatccatgtgttgtgttatttttacttgttaattaataattgggttgagttgcagattgaatgaggatatgattgagtcactattcatggcaaataa 34466864  T
111 tcccaattctagtggaaattctgctttggcttctaatcctaaagataatgctaggcatcaaataattcatgcttctccaatgccacctgaaaatagggta 210  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34466865 ttccaattctagtggaaattctgctttggcttctaatcctaaagataatgctaggcatcaaataattcatgcttctccaatgccacctgaaaatagggta 34466964  T
211 cttgatcctaagaagtctcagaacattgccattttgcttcgagcactgaatgtaataattg 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
34466965 cttgatcctaagaagtctcagaacattgccattttgcttcgagcactgaatgtaacaattg 34467025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105542 times since January 2019
Visitors: 2328