View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-8 (Length: 501)

Name: F9303-LTR4-TNT-insertion-8
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-8
F9303-LTR4-TNT-insertion-8
[»] chr7 (3 HSPs)
chr7 (7-493)||(47871193-47871679)
chr7 (7-493)||(47873866-47874352)
chr7 (48-95)||(22875038-22875085)
[»] chr4 (9 HSPs)
chr4 (28-493)||(36930922-36931387)
chr4 (68-179)||(5820862-5820970)
chr4 (27-293)||(36934270-36934536)
chr4 (363-441)||(36934122-36934200)
chr4 (28-113)||(36939266-36939351)
chr4 (28-113)||(36941767-36941852)
chr4 (7-114)||(36949494-36949601)
chr4 (7-114)||(36959628-36959735)
chr4 (232-409)||(36941971-36942148)


Alignment Details
Target: chr7 (Bit Score: 487; Significance: 0; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Complemental strand, 47871679 - 47871193
Alignment:
7 agctttgcattgaaactatcgtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47871679 agctttgcattgaaactatcgtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccg 47871580  T
107 aagccaaatccatagcaatgttgtacctcacttgccatgtcaatatgctttttccgcgatataggtgagaatctaagctaccattttgcatgaactcgta 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47871579 aagccaaatccatagcaatgttgtacctcacttgccatgtcaatatgctttttccgcgatataggtgagaatctaagctaccattttgcatgaactcgta 47871480  T
207 tataaggaggaagtcttttttcatgtgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttcagttgcatattcc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47871479 tataaggaggaagtcttttttcatgtgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttcagttgcatattcc 47871380  T
307 tttatcccttgtttagactctcttgatattctctttatagcaacattggaatctatgtctttcaaatagcctttataaacaccaccaaaaccaccttgtc 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47871379 tttatcccttgtttagactctcttgatattctctttatagcaacattggaatctatgtctttcaaatagcctttataaacaccaccaaaaccaccttgtc 47871280  T
407 ctatcttttgtgtttcttcaaagttattggttgcacttaccaatttattatagcaaaactttttaggtccagttcccttttggaatt 493  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47871279 ctatcttttgtgtttcttcaaagttattggttgcacttaccaatttattatagcaaaactttttaggtccagttcccttttggaatt 47871193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 7 - 493
Target Start/End: Original strand, 47873866 - 47874352
Alignment:
7 agctttgcattgaaactatcgtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccg 106  Q
    ||||| ||||||||| | | ||| ||||| |||||||||||||| |  || ||||||| ||||||||||||||||||||||||||| ||||| | ||| |    
47873866 agcttagcattgaaattgttgtctaacatgatgttgctggatttgacatccctatgaagcacacattgttcccattcttcatgaaggtacaaaagtgctg 47873965  T
107 aagccaaatccatagcaatgttgtacctcacttgccatgtcaatatgctttttccgcgatataggtgagaatctaagctaccattttgcatgaactcgta 206  Q
    ||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||| ||    
47873966 aagccaagtccatagcaatgttgtacctcatttgccatgtcaatacgctttttccgcggtatagatgagaatctaagctaccattttgcatgaactcata 47874065  T
207 tataaggaggaagtcttttttcatgtgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttcagttgcatattcc 306  Q
    |||||||||||||||  ||||| |||||||||||||||||||||||||||||||||| || ||||| |||| ||||||||||||||||||||||||||||    
47874066 tataaggaggaagtcccttttcttgtgacaccaaccaattagttgtactaaattcctatgtctaagctggccaatgatcttcacttcagttgcatattcc 47874165  T
307 tttatcccttgtttagactctcttgatattctctttatagcaacattggaatctatgtctttcaaatagcctttataaacaccaccaaaaccaccttgtc 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |    
47874166 tttatcccttgtttagactctcttgatattctctttatagcaacattggtatctatatctttcaaatagcctttataaacaccaccaaaaccaccttgcc 47874265  T
407 ctatcttttgtgtttcttcaaagttattggttgcacttaccaatttattatagcaaaactttttaggtccagttcccttttggaatt 493  Q
    ||||||||| || |||| |||||||||| |||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||    
47874266 ctatcttttctgcttctgcaaagttatttgttgcactcaccaatttgttatagcaaaactttttaggtccagtgcccttttggaatt 47874352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 95
Target Start/End: Original strand, 22875038 - 22875085
Alignment:
48 ttttatgtctctatgaatcacacattgttcccattcttcatgaagata 95  Q
    ||||||||||||||||||||||  || ||||||||||||||| |||||    
22875038 ttttatgtctctatgaatcacaactttttcccattcttcatgtagata 22875085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 118; Significance: 5e-60; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 28 - 493
Target Start/End: Complemental strand, 36931387 - 36930922
Alignment:
28 tccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccgaagccaaatccatagcaatgt 127  Q
    |||||||||||||| |||||||| ||||| || |||| |||||| |||||||||||||| || || || | |||||| ||||||||  |||  || || |    
36931387 tccaacataatgttactggatttaatgtccctgtgaagcacacactgttcccattcttcctgtaggtaaagcaatgctgaagccaagcccaatgctatat 36931288  T
128 tgtacctcacttgccatgtcaatatgctttttccgcgatataggtgagaatctaagctaccattttgcatgaactcgtatataaggaggaagtctttttt 227  Q
    | ||||||| |  ||||||||||| ||| |||   |  ||||| |||||||||||||| ||||||  ||||||||| |||||||| || || || || ||    
36931287 tatacctcattgtccatgtcaataagctctttttactgtatagatgagaatctaagcttccatttgacatgaactcatatataagaagaaaatcattctt 36931188  T
228 catgtgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttcagttgcatattcctttatcccttgtttagactct 327  Q
    | | || ||||||||||  |||||||||||||||||||| || | |||||| |||| |||||||||||| || |||||   ||| || ||| ||||||||    
36931187 cctatggcaccaaccaagaagttgtactaaattcctgtgtctcaattggcttatgaccttcacttcagtggcgtattctagtattccctgtctagactct 36931088  T
328 cttgatattctctttatagcaacattggaatctatgtctttcaaatagcctttataaacaccaccaaaaccaccttgtcctatcttttgtgtttcttcaa 427  Q
    |||||||| ||||| | |||||||| ||||| || |||||||||||| ||||| || |||||||||||||||||||| |||| |||   ||  |||  ||    
36931087 cttgatatcctcttgacagcaacataggaatttaagtctttcaaataacctttgtatacaccaccaaaaccaccttgccctaccttacctgactctgaaa 36930988  T
428 agttattggttgcacttaccaatttattatagcaaaactttttaggtccagttcccttttggaatt 493  Q
    | ||||| |||||||| || | || ||| ||| ||||  | |||||||||| ||||||||||||||    
36930987 atttatttgttgcactcactagttcattgtaggaaaatctcttaggtccagatcccttttggaatt 36930922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 68 - 179
Target Start/End: Complemental strand, 5820970 - 5820862
Alignment:
68 cacattgttcccattcttcatgaagatacaacaatgccgaagccaaatccatagcaatgttgtacctcacttgccatgtcaatatgctttttccgcgata 167  Q
    ||||||||||||||||||||||||| ||||||||||| |   ||||||||||| |||||||||| ||||  ||| ||||||||||| ||||||| |||||    
5820970 cacattgttcccattcttcatgaaggtacaacaatgctg---ccaaatccataacaatgttgtagctcatatgcaatgtcaatatgatttttccacgata 5820874  T
168 taggtgagaatc 179  Q
    | ||||||||||    
5820873 ttggtgagaatc 5820862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 27 - 293
Target Start/End: Complemental strand, 36934536 - 36934270
Alignment:
27 gtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccgaagccaaatccatagcaatg 126  Q
    ||||||||| |||||||| ||||||||||| |||||||||||||||| |||||||||||| || | ||| | ||||||||| |||||  | | ||| ||     
36934536 gtccaacattatgttgcttgattttatgtccctatgaatcacacatttttcccattcttcctgcaaataaagcaatgccgaggccaacccaagagctata 36934437  T
127 ttgtacctcacttgccatgtcaatatgctttttccgcgatataggtgagaatctaagctaccattttgcatgaactcgtatataaggaggaagtcttttt 226  Q
    |||||||| |  | ||| | ||| ||||||  ||||||| | || ||| | |||||||| |||||  ||||| | |||||||| ||||  |  || || |    
36934436 ttgtaccttaagttccaaggcaagatgcttcctccgcgaaaaagatgaaagtctaagctgccattaggcatgtattcgtatatcaggataagttcattct 36934337  T
227 tcatgtgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttc 293  Q
    || |||| ||||||||| | ||||  |||||||| || ||||| |  ||||||||||||||||||||    
36934336 tcttgtggcaccaaccagtgagtttcactaaatttctatgcctcaactggctaatgatcttcacttc 36934270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 363 - 441
Target Start/End: Complemental strand, 36934200 - 36934122
Alignment:
363 gtctttcaaatagcctttataaacaccaccaaaaccaccttgtcctatcttttgtgtttcttcaaagttattggttgca 441  Q
    |||||| |||||||| ||||||||||| |||||||||||||| |||| ||| ||||| ||||||||||| || ||||||    
36934200 gtctttaaaatagcccttataaacaccgccaaaaccaccttggcctagcttctgtgtctcttcaaagttgtttgttgca 36934122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 28 - 113
Target Start/End: Complemental strand, 36939351 - 36939266
Alignment:
28 tccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccgaagccaa 113  Q
    |||||||| ||||| || | ||||||||||||||| |  ||||||||||||||||||||||| | ||| |||| ||| ||||||||    
36939351 tccaacatgatgttacttgcttttatgtctctatgtacaacacattgttcccattcttcatgcaaatataacagtgcagaagccaa 36939266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 28 - 113
Target Start/End: Original strand, 36941767 - 36941852
Alignment:
28 tccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccgaagccaa 113  Q
    |||||||| ||||| || | ||||||||||||||| |  ||||||||||||||||||||||| |  ||||||||||| || |||||    
36941767 tccaacatgatgttacttgcttttatgtctctatgtacaacacattgttcccattcttcatgcaagtacaacaatgcagatgccaa 36941852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 36949601 - 36949494
Alignment:
7 agctttgcattgaaactatcgtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccg 106  Q
    ||||||| ||||||| ||   ||||||||||  ||||| ||||||||||||||||| | |||||| || || || |||||||| || ||||| |||||||    
36949601 agctttgtattgaaattagaatccaacataacattgcttgattttatgtctctatgtagcacacaatgctcacactcttcatgcaggtacaataatgccg 36949502  T
107 aagccaaa 114  Q
    | ||||||    
36949501 aggccaaa 36949494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 36959735 - 36959628
Alignment:
7 agctttgcattgaaactatcgtccaacataatgttgctggattttatgtctctatgaatcacacattgttcccattcttcatgaagatacaacaatgccg 106  Q
    ||||||| ||||||| ||   ||||||||||  ||||| ||||||||||||||||| | |||||| || || || |||||||| || ||||| |||||||    
36959735 agctttgtattgaaattagaatccaacataacattgcttgattttatgtctctatgtagcacacaatgctcacactcttcatgcaggtacaataatgccg 36959636  T
107 aagccaaa 114  Q
    | ||||||    
36959635 aggccaaa 36959628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 232 - 409
Target Start/End: Original strand, 36941971 - 36942148
Alignment:
232 tgacaccaaccaattagttgtactaaattcctgtgcctaagttggctaatgatcttcacttcagttgcatattcctttatcccttgtttagactctcttg 331  Q
    |||||||||||||| | ||| |||| ||| || ||||| | || |||||| ||| | ||||| | |||| |||||||||||||||| | ||| |||  ||    
36941971 tgacaccaaccaatcaattgcactagatttctatgccttaatttgctaattatcgttacttctgatgcaaattcctttatcccttgatgagaatcttctg 36942070  T
332 atattctctttatagcaacattggaatctatgtctttcaaatagcctttataaacaccaccaaaaccaccttgtccta 409  Q
    | |  ||||| ||||||||||  || | | ||||||| | | ||||| |||||||||| ||||| || ||||||||||    
36942071 acacactcttaatagcaacataagattttgtgtcttttagaaagcctctataaacacctccaaatcctccttgtccta 36942148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 94904 times since January 2019
Visitors: 2221