View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9305-LTR4-TNT-insertion-1 (Length: 428)

Name: F9305-LTR4-TNT-insertion-1
Description: F9305-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9305-LTR4-TNT-insertion-1
F9305-LTR4-TNT-insertion-1
[»] chr4 (3 HSPs)
chr4 (8-418)||(13617383-13617793)
chr4 (88-154)||(20295574-20295640)
chr4 (222-385)||(52352780-52352941)
[»] chr1 (2 HSPs)
chr1 (18-418)||(7580641-7581037)
chr1 (10-418)||(7100209-7100613)
[»] chr5 (22 HSPs)
chr5 (74-418)||(17983686-17984026)
chr5 (10-158)||(29854355-29854503)
chr5 (10-154)||(29873222-29873366)
chr5 (34-402)||(30207326-30207690)
chr5 (28-158)||(30061416-30061546)
chr5 (28-158)||(30337457-30337587)
chr5 (28-158)||(30750690-30750820)
chr5 (28-154)||(30401122-30401248)
chr5 (34-154)||(30676226-30676346)
chr5 (69-154)||(30712401-30712486)
chr5 (10-154)||(17417507-17417651)
chr5 (319-402)||(29872978-29873059)
chr5 (34-154)||(30520563-30520683)
chr5 (34-154)||(30560903-30561023)
chr5 (71-150)||(30330184-30330263)
chr5 (321-359)||(30400919-30400957)
chr5 (112-154)||(30436861-30436903)
chr5 (10-104)||(30476473-30476567)
chr5 (273-385)||(30476196-30476306)
chr5 (69-154)||(30484449-30484534)
chr5 (317-409)||(30520844-30520934)
chr5 (317-409)||(30561184-30561274)
[»] chr3 (1 HSPs)
chr3 (34-402)||(25292885-25293249)
[»] chr7 (1 HSPs)
chr7 (69-154)||(26708380-26708465)


Alignment Details
Target: chr4 (Bit Score: 381; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 8 - 418
Target Start/End: Complemental strand, 13617793 - 13617383
Alignment:
8 gttgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13617793 gttgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtga 13617694  T
108 gggcctctgactttctttctgactatcccattgttggtttaggtggtgttgcnnnnnnnnnnctcctgctcaaattgtctaaaatgatgataaggtgggt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||    
13617693 gggcctctgactttctttctgactatcccattgttggtttaggtggtgttgcaaaaaaaaaactcctgctcaaattgtctaaaatgatgataaggtgggt 13617594  T
208 gacaatttcaaaacaaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtg 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13617593 gacaatttcaaaacaaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtg 13617494  T
308 atgcaacatatttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13617493 atgcaacatatttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaa 13617394  T
408 gagtttgaatt 418  Q
    |||||||||||    
13617393 gagtttgaatt 13617383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 20295574 - 20295640
Alignment:
88 gtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    ||||| ||||||||| | || || |||||||||  |||||| |||||||||||||||||||||||||    
20295574 gtttcttctcacccatgcgaaggactctgacttcatttctgtctatcccattgttggtttaggtggt 20295640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 385
Target Start/End: Complemental strand, 52352941 - 52352780
Alignment:
222 aaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtgatgcaacatattta 321  Q
    |||||||||||| ||| |||  |||| ||||||  || | || ||||||  ||||||||||||||| || |||| | | ||||||||||    | |||||    
52352941 aaaaatttgggtttgtgtttctgaggatttctctgtcaataggattttgtgttccattatagaatctattacaagagaaaagtgtgatggcttagattta 52352842  T
322 gatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttgga 385  Q
    ||||| ||||||||||  | ||||||| || ||||||  ||||||||| |||| | ||||||||    
52352841 gatgtgatacaaagaagagcgcaagaattgttgcaag--gtaaaagatatttgttggttttgga 52352780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 418
Target Start/End: Original strand, 7580641 - 7581037
Alignment:
18 gccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctga 117  Q
    ||||||| | ||||| |||||| ||| ||||||||||||||||| ||||| ||||||||| |||||||  ||||| ||||||||||| ||||| ||| ||    
7580641 gccaaaccagctccattattgccgaaccaaaggtgtttggacgagaagatgataaagagaggattgttgagtttcttctcacccaagcgagggactcgga 7580740  T
118 ctttctttctgactatcccattgttggtttaggtggtgttgcnnnnnnnnnnctcctgctcaaattgtctaaaatgatgataaggtgggtgacaatttca 217  Q
    ||| ||||| | |||||| ||||||||||||||||||||||           ||| ||||||| | ||||| || ||||||| |||| || |||||||||    
7580741 cttcctttccgtctatccaattgttggtttaggtggtgttg--gaaaaacaactcttgctcaattggtctacaacgatgatagggtgagtcacaatttca 7580838  T
218 aaacaaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtgatgcaacata 317  Q
    |||||||||||||||| ||| ||| |||||| |||||  || || | ||||||  |||||||||||||||||||||||||||||||||||||||||        
7580839 aaacaaaaatttgggtttgtgtttcagaggtattctcggtcaaggggattttgtgttccattatagaatccatgacaaaacagaagtgtgatgcaatggg 7580938  T
318 tttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaagagtttgaat 417  Q
    |||||||||||||||||||||||||||||||||| ||||||  | ||||||  |||||| ||||||||||| |||||||  ||||||||||| |||||||    
7580939 tttagatgtaatacaaagaaaggtgcaagaaatgttgcaag--gaaaaagacgtttgctggttttggacgatgtttggataaaaagtcaagaatttgaat 7581036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 10 - 418
Target Start/End: Complemental strand, 7100613 - 7100209
Alignment:
10 tgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagg 109  Q
    ||||||| ||||||| | ||||  |||||||||| ||||| ||||||||||| ||||| |||||||||||||||||  ||||| |||||||||||  | |    
7100613 tgaatggcgccaaaccagctcctttattgctgaaccaaagatgtttggacgagaagatgataaagagaagattgttgagtttcttctcacccaagcaaag 7100514  T
110 gcctctgactttctttctgactatcccattgttggtttaggtggtgttgcnnnnnnnnnnctcctgctcaaattgtctaaaatgatgataaggtgggtga 209  Q
    | ||||||||| || || | |||||||||||| ||||||||||||||||           ||| | ||||| | || || |||||||||| |||| ||||    
7100513 gactctgacttcctatccgtctatcccattgtcggtttaggtggtgttg--gaaaaacaactctttctcaattggtttacaatgatgatagggtgagtga 7100416  T
210 caatttcaaaacaaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtgat 309  Q
    |||||||||||||||||||||||| ||| ||| ||||||||||||| || || | ||||||  ||||||||||||||||||||||||||| |||||||||    
7100415 caatttcaaaacaaaaatttgggtttgtgtttcagaggttttctcagtcaaggggattttgtgttccattatagaatccatgacaaaacaaaagtgtgat 7100316  T
310 gcaacatatttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaaga 409  Q
     |||   | |||||||||||||||||||| |||||||||||| ||||||  ||| ||||| |||| | |||||||| || || |||||||||| | ||||    
7100315 tcaatggagttagatgtaatacaaagaaaagtgcaagaaatgatgcaag--gtacaagatgtttgttggttttggatgatgtgtggaacaaaaatgaaga 7100218  T
410 gtttgaatt 418  Q
     ||||||||    
7100217 atttgaatt 7100209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 96; Significance: 6e-47; HSPs: 22)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 74 - 418
Target Start/End: Complemental strand, 17984026 - 17983686
Alignment:
74 gagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttaggtggtgttgcnnnnnnnnnnctcc 173  Q
    ||||||||||||  ||||| ||||||||||| ||||  ||||||||| ||||| | ||||||||||||||| |||||||||||||           |||     
17984026 gagaagattgttgagtttcttctcacccaagcgaggttctctgacttcctttccgtctatcccattgttgggttaggtggtgttg--gaaaaacaactct 17983929  T
174 tgctcaaattgtctaaaatgatgataaggtgggtgacaatttcaaaacaaaaatttgggtatgtattttagaggttttctcaatctagagaattttgctt 273  Q
    ||||||| | ||||| || |||||||| ||| |||| | ||||||||||||||||||||| ||  ||| | ||||||||||| || || ||||||||  |    
17983928 tgctcaattggtctacaacgatgataacgtgagtgaaattttcaaaacaaaaatttgggtttgggtttcaaaggttttctcagtcaagggaattttgtgt 17983829  T
274 tccattatagaatccatgacaaaacagaagtgtgatgcaacatatttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagattttt 373  Q
    ||| ||||||||||||||||| |||| || | ||||| || |  |||||| ||||||||||||||||||||||||||| |||||   |||||||||  ||    
17983828 tccgttatagaatccatgacagaacaaaaatttgatgaaataggtttagaggtaatacaaagaaaggtgcaagaaatgttgcaa--cgtaaaagatgctt 17983731  T
374 gcttgttttggacgacgtttggaacaaaagtcaagagtttgaatt 418  Q
    | | ||||| ||||| || |||||||||||| |||| ||||||||    
17983730 gttggttttcgacgatgtgtggaacaaaagtgaagaatttgaatt 17983686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 10 - 158
Target Start/End: Complemental strand, 29854503 - 29854355
Alignment:
10 tgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagg 109  Q
    ||||||| | ||||| | ||||| |||||||||| |||| |||||||||||| ||||| ||||||| |||||||||  ||||| ||||||||||  ||||    
29854503 tgaatggcgtcaaaccagctccattattgctgaaccaaaagtgtttggacgagaagatgataaagaaaagattgttgagtttcttctcacccaaacgagg 29854404  T
110 gcctctgactttctttctgactatcccattgttggtttaggtggtgttg 158  Q
    | ||| ||||| ||||| | |||||||||| ||||||||||||||||||    
29854403 gactcagacttcctttccgtctatcccatttttggtttaggtggtgttg 29854355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 10 - 154
Target Start/End: Complemental strand, 29873366 - 29873222
Alignment:
10 tgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagg 109  Q
    ||||||| | ||||| | ||||| ||||| |||| |||| || ||||||||| ||||| ||||||| |||||||||  ||||| ||||||||||| ||||    
29873366 tgaatggcgtcaaaccagctccattattgttgaaccaaaagtatttggacgagaagatgataaagaaaagattgttgagtttcttctcacccaagcgagg 29873267  T
110 gcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    | ||||||||| ||||| | |||||||||||||||||||||||||    
29873266 gactctgacttcctttccgtctatcccattgttggtttaggtggt 29873222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 34 - 402
Target Start/End: Complemental strand, 30207690 - 30207326
Alignment:
34 tattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactat 133  Q
    |||||||||| |||| || ||||| ||| ||||| |||||||||||||| |   ||||| ||||||||||| ||||| ||| ||||| ||||| | ||||    
30207690 tattgctgaaccaaaagtatttgggcgagaagatgataaagagaagattatcgagtttcttctcacccaagcgagggactccgacttcctttccgtctat 30207591  T
134 cccattgttggtttaggtggtgttgcnnnnnnnnnnctcctgctcaaattgtctaaaatgatgataaggtgggtgacaatttcaaaacaaaaatttgggt 233  Q
    |||||||||||||||||||||||||           ||| || |||| | ||||| ||||||| || |||| ||  |||||| || |||||||| |||||    
30207590 cccattgttggtttaggtggtgttg--gaaaaacaactcttgttcaattggtctacaatgatgctagggtgagtagcaattttaatacaaaaatatgggt 30207493  T
234 atgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtga-tgcaacatatttagatgtaataca 332  Q
     ||| |||  |||  ||||||  || |||| ||||||   |||||||||||||| || |||| | |||||| |||  ||  || ||||||||||||||||    
30207492 ttgtgtttccgagactttctcggtcaagaggattttgtgctccattatagaatctatcacaagagagaagtatgacggcttca-atttagatgtaataca 30207394  T
333 aagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaa 402  Q
    |||||||||||| ||| |||||||||  |||||| || ||||||  ||||||| || || ||||||||||    
30207393 aagaaaggtgcaggaattgctgcaag--gtaaaatatatttgctgattttggatgatgtgtggaacaaaa 30207326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 28 - 158
Target Start/End: Complemental strand, 30061546 - 30061416
Alignment:
28 ctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttct 127  Q
    ||||| |||||||||| |||| |||||||||||| ||| | ||||||| |||||||||  ||||| |||||||||||  |||| ||||||||| |||||     
30061546 ctccattattgctgaaccaaaagtgtttggacgagaagttgataaagaaaagattgttgagtttcttctcacccaagcaagggactctgacttcctttcc 30061447  T
128 gactatcccattgttggtttaggtggtgttg 158  Q
    | ||||||||| |||||||||||||||||||    
30061446 gtctatcccatagttggtttaggtggtgttg 30061416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 28 - 158
Target Start/End: Original strand, 30337457 - 30337587
Alignment:
28 ctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttct 127  Q
    ||||| |||||||||| |||| |||||||||||| ||| | ||||||| |||||||||  ||||| ||||||||||| || || ||||||||| |||||     
30337457 ctccattattgctgaaccaaaagtgtttggacgagaagttgataaagaaaagattgttgagtttcttctcacccaagcgaaggactctgacttcctttcc 30337556  T
128 gactatcccattgttggtttaggtggtgttg 158  Q
    | ||||||||| |||||||||||||||||||    
30337557 gtctatcccatagttggtttaggtggtgttg 30337587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 28 - 158
Target Start/End: Complemental strand, 30750820 - 30750690
Alignment:
28 ctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttct 127  Q
    ||||| |||||||||| |||| |||||||||||| ||| | ||||||| ||||||| |  ||||| |||||||||||  |||| ||||||||| |||||     
30750820 ctccattattgctgaaccaaaagtgtttggacgagaagttgataaagaaaagattgctgagtttcttctcacccaagcaagggactctgacttcctttcc 30750721  T
128 gactatcccattgttggtttaggtggtgttg 158  Q
    | ||||||||| |||||||||||||||||||    
30750720 gtctatcccatagttggtttaggtggtgttg 30750690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 28 - 154
Target Start/End: Complemental strand, 30401248 - 30401122
Alignment:
28 ctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttct 127  Q
    ||||| ||||||| || || | |||||||||||| ||||| ||||||| |||||| ||  ||||| ||||||||| | ||||| ||||||||| |||||     
30401248 ctccattattgctaaaccagaagtgtttggacgaaaagatgataaagaaaagatttttgagtttcttctcacccatgcgagggactctgacttcctttcc 30401149  T
128 gactatcccattgttggtttaggtggt 154  Q
    | ||| |||||||||||||||||||||    
30401148 gtctaccccattgttggtttaggtggt 30401122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 30676226 - 30676346
Alignment:
34 tattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactat 133  Q
    ||||||||||||||| |||||||||||| ||| | || |||| ||||||||   ||||| ||||||||| | || || |||||||||  |||||| ||||    
30676226 tattgctgaatcaaaagtgtttggacgagaagttgatcaagaaaagattgtcgagtttcttctcacccatgcgaaggactctgacttcatttctgtctat 30676325  T
134 cccattgttggtttaggtggt 154  Q
    |||||| ||||||||||||||    
30676326 cccatttttggtttaggtggt 30676346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 69 - 154
Target Start/End: Original strand, 30712401 - 30712486
Alignment:
69 ataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    ||||||| ||||||||   ||||| ||||||||| | || || |||||||||  |||||| |||||||||||||||||||||||||    
30712401 ataaagaaaagattgtcgagtttcttctcacccatgcgaaggactctgacttcatttctgtctatcccattgttggtttaggtggt 30712486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 154
Target Start/End: Original strand, 17417507 - 17417651
Alignment:
10 tgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagg 109  Q
    ||||||| ||||||| | ||||  |||||||||| ||||||||||||||||  ||||| ||| | |||||||||||  |||||  ||||||||||  |||    
17417507 tgaatggcgccaaaccagctcctttattgctgaaccaaaggtgtttggacgggaagatgatacaaagaagattgttgagtttctgctcacccaagcaagg 17417606  T
110 gcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    |  | |||  | ||||| | ||||||||| ||||| |||||||||    
17417607 gattgtgaaatcctttcagtctatcccatagttgggttaggtggt 17417651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 402
Target Start/End: Complemental strand, 29873059 - 29872978
Alignment:
319 ttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaa 402  Q
    |||||||||||  ||||||||||||||||| |||||||||  |||||| || |||||| |||||||| ||  | ||||||||||    
29873059 ttagatgtaatggaaagaaaggtgcaagaagtgctgcaag--gtaaaaaatatttgctcgttttggatgatctgtggaacaaaa 29872978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 30520563 - 30520683
Alignment:
34 tattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactat 133  Q
    |||||||||| |||| || | ||| ||| ||||| ||||||||||||||||   ||||| |||||||||||  | || ||||||| | |||||   ||||    
30520563 tattgctgaaccaaaagtatatggtcgagaagatgataaagagaagattgtcgagtttcttctcacccaagcaaagggctctgacctcctttccatctat 30520662  T
134 cccattgttggtttaggtggt 154  Q
    || |||||||| |||||||||    
30520663 ccaattgttggcttaggtggt 30520683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 30560903 - 30561023
Alignment:
34 tattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactat 133  Q
    |||||||||| |||| || | ||| ||| ||||| ||||||||||||||||   ||||| |||||||||||  | || ||||||| | |||||   ||||    
30560903 tattgctgaaccaaaagtatatggtcgagaagatgataaagagaagattgtcgagtttcttctcacccaagcaaagggctctgacctcctttccatctat 30561002  T
134 cccattgttggtttaggtggt 154  Q
    || |||||||| |||||||||    
30561003 ccaattgttggcttaggtggt 30561023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 71 - 150
Target Start/End: Original strand, 30330184 - 30330263
Alignment:
71 aaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttagg 150  Q
    ||||| |||||||| | ||||| ||||||||||| ||||| | ||||||| |||||   ||||||||| |||||||||||    
30330184 aaagataagattgtcaagtttcttctcacccaagcgagggacactgacttcctttccatctatcccatagttggtttagg 30330263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 321 - 359
Target Start/End: Complemental strand, 30400957 - 30400919
Alignment:
321 agatgtaatacaaagaaaggtgcaagaaatgctgcaagg 359  Q
    |||||||||||||||||||||||||||| || |||||||    
30400957 agatgtaatacaaagaaaggtgcaagaattgttgcaagg 30400919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 154
Target Start/End: Complemental strand, 30436903 - 30436861
Alignment:
112 ctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    |||||||||| |||||| ||||||| |||||||||||||||||    
30436903 ctctgactttatttctgtctatcccgttgttggtttaggtggt 30436861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 30476567 - 30476473
Alignment:
10 tgaatggtgccaaacgatctccactattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaag 104  Q
    ||||||| ||||||| | ||||| |||||||||| | || ||||||||||||  |||| ||| ||||| ||||||   ||||| |||||||||||    
30476567 tgaatggcgccaaacaagctccattattgctgaacccaaagtgtttggacgagtagatgatagagagaggattgtcgagtttcttctcacccaag 30476473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 385
Target Start/End: Complemental strand, 30476306 - 30476196
Alignment:
273 ttccattatagaatccatgacaaaacagaagtgtgatgcaacatatttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttt 372  Q
    ||||||||||||||| || |||||| | |||| ||||||     |||||||||||||||||||||| |  | |||| |  ||||||  ||||||||||||    
30476306 ttccattatagaatctatcacaaaagacaagtttgatgccttggatttagatgtaatacaaagaaaagcacgagaactattgcaag--gtaaaagatttt 30476209  T
373 tgcttgttttgga 385  Q
    |||| ||||||||    
30476208 tgctggttttgga 30476196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 30484534 - 30484449
Alignment:
69 ataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    ||||||| ||||||||   ||||| ||||||| | | || || |||| ||||  |||||| |||||||||||||||||||||||||    
30484534 ataaagaaaagattgtcgagtttcttctcacctatgcgaaggactctaacttcatttctgtctatcccattgttggtttaggtggt 30484449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 409
Target Start/End: Original strand, 30520844 - 30520934
Alignment:
317 atttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaaga 409  Q
    |||||||||| |||||| || | ||||||||| || || |||||  ||||||| ||||||||||||||| || || ||||||| || ||||||    
30520844 atttagatgttatacaacgacaagtgcaagaattgttggaaggt--aaaagatatttgcttgttttggatgatgtgtggaacagaaatcaaga 30520934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 409
Target Start/End: Original strand, 30561184 - 30561274
Alignment:
317 atttagatgtaatacaaagaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaagtcaaga 409  Q
    |||||||||| |||||| || | ||||||||| || || |||||  ||||||| ||||||||||||||| || || ||||||| || ||||||    
30561184 atttagatgttatacaacgacaagtgcaagaattgttggaaggt--aaaagatatttgcttgttttggatgatgtgtggaacagaaatcaaga 30561274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 34 - 402
Target Start/End: Original strand, 25292885 - 25293249
Alignment:
34 tattgctgaatcaaaggtgtttggacgataagataataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactat 133  Q
    |||||| ||| |||| || ||||||||| ||||| |||||||||||| |||   ||||| ||| |||||||  |||| ||||||||| ||||| | | ||    
25292885 tattgccgaaccaaaagtatttggacgagaagatgataaagagaagactgtcgagtttcttcttacccaagcaagggactctgacttcctttccgtccat 25292984  T
134 cccattgttggtttaggtggtgttgcnnnnnnnnnnctcctgctcaaattgtctaaaatgatgataaggtgggtgacaatttcaaaacaaaaatttgggt 233  Q
    |||||||||||||||||||||||||           ||| || |||| | ||||| ||||||| || |||| ||  || ||| || ||||||||||||||    
25292985 cccattgttggtttaggtggtgttg--gaaaaacaactcttgttcaattggtctacaatgatgttagggtgagtagcacttttaatacaaaaatttgggt 25293082  T
234 atgtattttagaggttttctcaatctagagaattttgctttccattatagaatccatgacaaaacagaagtgtgatgcaacatatttagatgtaatacaa 333  Q
     ||| |||  |||  ||||||  || |||| ||||||  ||||||||||||||| || || | | |||||||||||||     |||||||||||||||||    
25293083 ttgtgtttctgagactttctcggtcaagaggattttgtgttccattatagaatctatcactagagagaagtgtgatgcctttgatttagatgtaatacaa 25293182  T
334 agaaaggtgcaagaaatgctgcaaggtgtaaaagatttttgcttgttttggacgacgtttggaacaaaa 402  Q
    ||||||||| ||||| |  ||||||  |||||| || ||||||| |||||||||| || ||||||||||    
25293183 agaaaggtgtaagaactattgcaag--gtaaaatatatttgcttattttggacgatgtgtggaacaaaa 25293249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 26708465 - 26708380
Alignment:
69 ataaagagaagattgttaggtttcatctcacccaagtgagggcctctgactttctttctgactatcccattgttggtttaggtggt 154  Q
    ||||||| ||||||||   ||||| ||||||||| | || || |||||||||  |||||| ||||||||||||||| |||||||||    
26708465 ataaagaaaagattgtcgagtttcttctcacccatgcgaaggactctgacttcatttctgtctatcccattgttggcttaggtggt 26708380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105609 times since January 2019
Visitors: 2328