View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9305-LTR4-TNT-insertion-4 (Length: 212)

Name: F9305-LTR4-TNT-insertion-4
Description: F9305-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9305-LTR4-TNT-insertion-4
[»] chr7 (1 HSPs)
chr7 (8-203)||(2473768-2473963)
[»] chr3 (1 HSPs)
chr3 (60-105)||(31866176-31866221)
[»] chr1 (1 HSPs)
chr1 (72-105)||(4539053-4539086)

Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 2473963 - 2473768
8 ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat 107  Q
2473963 ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat 2473864  T
108 aaaaaagtagatgttgcaacaaataataagtnnnnnnnctcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg 203  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2473863 aaaaaagtagatgttgcaacaaataataagtaaaaaaactcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg 2473768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 105
Target Start/End: Complemental strand, 31866221 - 31866176
60 gagaatattaacgtgtcaagtgtgagttagaagccccacattggat 105  Q
    ||||||||| | ||||||||||||||||||||| | ||||||||||    
31866221 gagaatattgatgtgtcaagtgtgagttagaagtctcacattggat 31866176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 105
Target Start/End: Complemental strand, 4539086 - 4539053
72 gtgtcaagtgtgagttagaagccccacattggat 105  Q
    ||||||||||||||||||||| ||||||||||||    
4539086 gtgtcaagtgtgagttagaagtcccacattggat 4539053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC