View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9305-LTR4-TNT-insertion-4 (Length: 212)

Name: F9305-LTR4-TNT-insertion-4
Description: F9305-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9305-LTR4-TNT-insertion-4
F9305-LTR4-TNT-insertion-4
[»] chr7 (1 HSPs)
chr7 (8-203)||(2473768-2473963)
[»] chr3 (1 HSPs)
chr3 (60-105)||(31866176-31866221)
[»] chr1 (1 HSPs)
chr1 (72-105)||(4539053-4539086)


Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 2473963 - 2473768
Alignment:
8 ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2473963 ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat 2473864  T
108 aaaaaagtagatgttgcaacaaataataagtnnnnnnnctcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg 203  Q
    |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2473863 aaaaaagtagatgttgcaacaaataataagtaaaaaaactcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg 2473768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 105
Target Start/End: Complemental strand, 31866221 - 31866176
Alignment:
60 gagaatattaacgtgtcaagtgtgagttagaagccccacattggat 105  Q
    ||||||||| | ||||||||||||||||||||| | ||||||||||    
31866221 gagaatattgatgtgtcaagtgtgagttagaagtctcacattggat 31866176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 105
Target Start/End: Complemental strand, 4539086 - 4539053
Alignment:
72 gtgtcaagtgtgagttagaagccccacattggat 105  Q
    ||||||||||||||||||||| ||||||||||||    
4539086 gtgtcaagtgtgagttagaagtcccacattggat 4539053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84081 times since January 2019
Visitors: 2323