View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9306-LTR4-TNT-insertion-1 (Length: 437)

Name: F9306-LTR4-TNT-insertion-1
Description: F9306-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9306-LTR4-TNT-insertion-1
F9306-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (10-429)||(8901873-8902292)


Alignment Details
Target: chr5 (Bit Score: 416; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 10 - 429
Target Start/End: Original strand, 8901873 - 8902292
Alignment:
10 aacaaagtcaccttcatcaagaatgggcttcacaatagcatactgtctcctcaacactgaatgtcggtttttgagtttttccttatcccatttcagacct 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8901873 aacaaagtcaccttcatcaagaatgggcttcacaatagcatactgtctcctcaacactgaatgtcggtttttgagtttttccttatcccatttcagacct 8901972  T
110 gttttgttgtgaaatccatcacaaatatgtttccatgctttcttattgaatgaattgttttgcttgttccctttgtgtacttggtcaactatcaaatctg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8901973 gttttgttgtgaaatccatcacaaatatgtttccatgctttcttattgaatgaattgttttgcttgttccctttgtgtacttggtcaaccatcaaatctg 8902072  T
210 ccagtatcttagtaagtgatgctgtccacttagcccttgactgttctagctgctgcgtttctagccttcttgatctggtaattcggcgtgccatctatat 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8902073 ccagtatcttagtaagtgatgctgtccacttagcccttgactgttctagctgctgcgtttctagccttcttgatctggtaattcggcgtgccatctatat 8902172  T
310 tttaactaacataagtaatcgataaagaggagtttaaacacatacagtcacacacaatatacactcatgaaaacacatgtttgcataaacctaagaggat 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8902173 tttaactaacataagtaatcgataaagaggagtttaaacacatacagtcacacacaatatacactcatgaaaacacatgtttgcataaacctaagaggat 8902272  T
410 gatcatagcaagagtgaatt 429  Q
    ||||||||||||||||||||    
8902273 gatcatagcaagagtgaatt 8902292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77528 times since January 2019
Visitors: 2275