View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9306-LTR4-TNT-insertion-1 (Length: 437)

Name: F9306-LTR4-TNT-insertion-1
Description: F9306-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9306-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (10-429)||(8901873-8902292)

Alignment Details
Target: chr5 (Bit Score: 416; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 10 - 429
Target Start/End: Original strand, 8901873 - 8902292
10 aacaaagtcaccttcatcaagaatgggcttcacaatagcatactgtctcctcaacactgaatgtcggtttttgagtttttccttatcccatttcagacct 109  Q
8901873 aacaaagtcaccttcatcaagaatgggcttcacaatagcatactgtctcctcaacactgaatgtcggtttttgagtttttccttatcccatttcagacct 8901972  T
110 gttttgttgtgaaatccatcacaaatatgtttccatgctttcttattgaatgaattgttttgcttgttccctttgtgtacttggtcaactatcaaatctg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8901973 gttttgttgtgaaatccatcacaaatatgtttccatgctttcttattgaatgaattgttttgcttgttccctttgtgtacttggtcaaccatcaaatctg 8902072  T
210 ccagtatcttagtaagtgatgctgtccacttagcccttgactgttctagctgctgcgtttctagccttcttgatctggtaattcggcgtgccatctatat 309  Q
8902073 ccagtatcttagtaagtgatgctgtccacttagcccttgactgttctagctgctgcgtttctagccttcttgatctggtaattcggcgtgccatctatat 8902172  T
310 tttaactaacataagtaatcgataaagaggagtttaaacacatacagtcacacacaatatacactcatgaaaacacatgtttgcataaacctaagaggat 409  Q
8902173 tttaactaacataagtaatcgataaagaggagtttaaacacatacagtcacacacaatatacactcatgaaaacacatgtttgcataaacctaagaggat 8902272  T
410 gatcatagcaagagtgaatt 429  Q
8902273 gatcatagcaagagtgaatt 8902292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC