View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9306-LTR4-TNT-insertion-4 (Length: 706)

Name: F9306-LTR4-TNT-insertion-4
Description: F9306-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9306-LTR4-TNT-insertion-4
F9306-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (9-698)||(11968311-11969000)
[»] chr2 (2 HSPs)
chr2 (88-238)||(22403318-22403471)
chr2 (11-76)||(41341032-41341098)
[»] scaffold0413 (1 HSPs)
scaffold0413 (37-143)||(8562-8668)
[»] chr6 (3 HSPs)
chr6 (37-143)||(10751840-10751946)
chr6 (150-244)||(194411-194501)
chr6 (637-698)||(20555050-20555113)
[»] chr4 (1 HSPs)
chr4 (144-238)||(40458479-40458571)
[»] chr1 (3 HSPs)
chr1 (144-238)||(43408341-43408433)
chr1 (640-698)||(36387606-36387664)
chr1 (144-238)||(37667732-37667824)


Alignment Details
Target: chr3 (Bit Score: 658; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 658; E-Value: 0
Query Start/End: Original strand, 9 - 698
Target Start/End: Original strand, 11968311 - 11969000
Alignment:
9 caggtttgaagaaaacaaaaatgacttaaattagaatttgatgaagtgagacaagggataaattagaagaacatatacgaaaaggacttgcacgaaaatt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
11968311 caggtttgaagaaaacaaaaatgacttaaattagaatttgatgaagtgagacaagggataaattagaagaacatatatgaaaaggacttgcacgaaaatt 11968410  T
109 attgacaagatgatagcatagggattgatcgatggggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11968411 attgacaagatgatagcatagggattgatcgatggggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctat 11968510  T
209 ggaaaataataagagaacattgtgataaggaatgatgtgtgatagatataagagaggcagtatatcgtacacatgatagtgagagaccggcaaggacacc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11968511 ggaaaataataagagaacattgtgataaggaatgatgtgtgatagatataagagaggcagtatatcgtacacatgatagtgagagaccggcaaggacacc 11968610  T
309 gttttgagagtcagagaaataaacaactaggagattttacatgtgatagaatgaaatagctaattagtagaactttgctccaactccatcaaattttaaa 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11968611 gttttgagagtcagagaaataaacaactaggagattttacatgtgatagaatgaaatagctaattagtagaactttgctccaactccatcaaattttaaa 11968710  T
409 cgtgggtgaattgtggagaaaccgtaaccactaactactctagtcggtcaaagttattattacctaaaagataggaacaaatgaatataaataaccatca 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11968711 cgtgggtgaattgtggagaaaccgtaaccactaactactctagtcggtcaaagttattattacctaaaagataggaacaaatgaatataaataaccatca 11968810  T
509 ttcaacgtggctggcatctttttagaaaaaacgtgggtagtannnnnnnncttcaatgtatattagttctattaacaagaataacaactatagtttcttg 608  Q
    ||||||||||||||||||||||||||||||||||||||||||        |||||| |||||||||||||||||||||||||||||||||||||||||||    
11968811 ttcaacgtggctggcatctttttagaaaaaacgtgggtagtattttttttcttcaaggtatattagttctattaacaagaataacaactatagtttcttg 11968910  T
609 ttctaattttcattgactacacatatttttatttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 698  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11968911 ttctaattttcattgactacacatatttttatttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 11969000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 88 - 238
Target Start/End: Complemental strand, 22403471 - 22403318
Alignment:
88 aaaaggacttgcacgaaaattatt-gacaagatgatagcatagggattgatcgatgg----ggaaattatttgtatacaacatgtaaatcaatggaatgt 182  Q
    |||||||||| ||||||||||||| ||||||||||  || |||| ||||||||||||    ||||  |||||||||||||||||| ||||||||||||||    
22403471 aaaaggacttacacgaaaattatttgacaagatgagggcttaggaattgatcgatggacttggaagatatttgtatacaacatgtgaatcaatggaatgt 22403372  T
183 tggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    |||||||| || ||  ||||| | ||   ||||||||||||||| || ||||||||    
22403371 tggagatgtatgct--caaagaccataagaaataataagagaactttttgataagg 22403318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 41341032 - 41341098
Alignment:
11 ggtttgaagaaaacaaaaatgacttaaattagaa-tttgatgaagtgagacaagggataaattagaa 76  Q
    ||||||| |||||| |||||||||||||| |||| ||| ||||||||| ||||| ||||||||||||    
41341032 ggtttgaggaaaacgaaaatgacttaaatcagaattttcatgaagtgaaacaagagataaattagaa 41341098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0413 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0413
Description:

Target: scaffold0413; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 37 - 143
Target Start/End: Complemental strand, 8668 - 8562
Alignment:
37 aattagaatttgatgaagtgagacaagggataaattagaagaacatatacg-aaaaggacttgcacgaaaattatt-gacaagatgatagcatagggatt 134  Q
    ||||||||||| ||  |||||||||||  ||||| | |||||||||||| | |||||||||| ||||||||||||| |||||||||||||||||| ||||    
8668 aattagaatttcat--agtgagacaagaaataaaatggaagaacatatatgcaaaaggacttacacgaaaattatttgacaagatgatagcatagagatt 8571  T
135 gatcgatgg 143  Q
    | |||||||    
8570 ggtcgatgg 8562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 143
Target Start/End: Original strand, 10751840 - 10751946
Alignment:
37 aattagaatttgatgaagtgagacaagggataaattagaagaacatatacg-aaaaggacttgcacgaaaattattga-caagatgatagcatagggatt 134  Q
    ||||||||||| ||  |||||||||||  ||||| | |||||||||||| | |||||||||||||| ||||||||| | |||||||||||||||| ||||    
10751840 aattagaatttcat--agtgagacaagaaataaaatggaagaacatatatgcaaaaggacttgcacaaaaattatttaacaagatgatagcatagagatt 10751937  T
135 gatcgatgg 143  Q
    | |||||||    
10751938 ggtcgatgg 10751946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 150 - 244
Target Start/End: Complemental strand, 194501 - 194411
Alignment:
150 tatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataaggaatgat 244  Q
    |||||||||||||||| | ||||||||||| |||||||||| || ||  ||||| |  ||| ||||||||||||| |||||||||| || |||||    
194501 tatttgtatacaacatatgaatcaatggaacgttggagatgtatgct--caaagac--tgggaaataataagagagcattgtgatatgggatgat 194411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 637 - 698
Target Start/End: Complemental strand, 20555113 - 20555050
Alignment:
637 ttatttatttattgttaaaaaca--attcaagctatttcttaatataaaaatttcccttaatta 698  Q
    ||||||||||||||| ||||| |  |||||  |||||||||| ||||| |||||||||||||||    
20555113 ttatttatttattgtaaaaaaaaccattcatcctatttcttactataagaatttcccttaatta 20555050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 238
Target Start/End: Complemental strand, 40458571 - 40458479
Alignment:
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| |||||||||||||||||| || |||||||||| || ||||| || ||  | ||| |||||  |||||||||||||||||||||||||||    
40458571 ggaaaatatttgtatacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatgagaaataataagagaacattgtgataagg 40458479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 238
Target Start/End: Original strand, 43408341 - 43408433
Alignment:
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| |||||||||||||||||| || |||||||||| || ||||| || ||  | ||| |||||  |||||||||||||||||||||||||||    
43408341 ggaaaatatttgtatacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatgagaaataataagagaacattgtgataagg 43408433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 640 - 698
Target Start/End: Original strand, 36387606 - 36387664
Alignment:
640 tttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 698  Q
    |||||||||| ||||||||||||||  |||||||||| ||||| |||||||||||||||    
36387606 tttatttatttttaaaaacaattcatcctatttcttactataagaatttcccttaatta 36387664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 238
Target Start/End: Original strand, 37667732 - 37667824
Alignment:
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| ||||| | |||||||||| || |||||||||| || ||||| || ||  | ||| |||| |||||||||| ||||||||||||||||||    
37667732 ggaaaatatttttctacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatagaaaataataggagaacattgtgataagg 37667824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC