View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9306-LTR4-TNT-insertion-4 (Length: 706)

Name: F9306-LTR4-TNT-insertion-4
Description: F9306-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9306-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (9-698)||(11968311-11969000)
[»] chr2 (2 HSPs)
chr2 (88-238)||(22403318-22403471)
chr2 (11-76)||(41341032-41341098)
[»] scaffold0413 (1 HSPs)
scaffold0413 (37-143)||(8562-8668)
[»] chr6 (3 HSPs)
chr6 (37-143)||(10751840-10751946)
chr6 (150-244)||(194411-194501)
chr6 (637-698)||(20555050-20555113)
[»] chr4 (1 HSPs)
chr4 (144-238)||(40458479-40458571)
[»] chr1 (3 HSPs)
chr1 (144-238)||(43408341-43408433)
chr1 (640-698)||(36387606-36387664)
chr1 (144-238)||(37667732-37667824)

Alignment Details
Target: chr3 (Bit Score: 658; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 658; E-Value: 0
Query Start/End: Original strand, 9 - 698
Target Start/End: Original strand, 11968311 - 11969000
9 caggtttgaagaaaacaaaaatgacttaaattagaatttgatgaagtgagacaagggataaattagaagaacatatacgaaaaggacttgcacgaaaatt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
11968311 caggtttgaagaaaacaaaaatgacttaaattagaatttgatgaagtgagacaagggataaattagaagaacatatatgaaaaggacttgcacgaaaatt 11968410  T
109 attgacaagatgatagcatagggattgatcgatggggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctat 208  Q
11968411 attgacaagatgatagcatagggattgatcgatggggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctat 11968510  T
209 ggaaaataataagagaacattgtgataaggaatgatgtgtgatagatataagagaggcagtatatcgtacacatgatagtgagagaccggcaaggacacc 308  Q
11968511 ggaaaataataagagaacattgtgataaggaatgatgtgtgatagatataagagaggcagtatatcgtacacatgatagtgagagaccggcaaggacacc 11968610  T
309 gttttgagagtcagagaaataaacaactaggagattttacatgtgatagaatgaaatagctaattagtagaactttgctccaactccatcaaattttaaa 408  Q
11968611 gttttgagagtcagagaaataaacaactaggagattttacatgtgatagaatgaaatagctaattagtagaactttgctccaactccatcaaattttaaa 11968710  T
409 cgtgggtgaattgtggagaaaccgtaaccactaactactctagtcggtcaaagttattattacctaaaagataggaacaaatgaatataaataaccatca 508  Q
11968711 cgtgggtgaattgtggagaaaccgtaaccactaactactctagtcggtcaaagttattattacctaaaagataggaacaaatgaatataaataaccatca 11968810  T
509 ttcaacgtggctggcatctttttagaaaaaacgtgggtagtannnnnnnncttcaatgtatattagttctattaacaagaataacaactatagtttcttg 608  Q
    ||||||||||||||||||||||||||||||||||||||||||        |||||| |||||||||||||||||||||||||||||||||||||||||||    
11968811 ttcaacgtggctggcatctttttagaaaaaacgtgggtagtattttttttcttcaaggtatattagttctattaacaagaataacaactatagtttcttg 11968910  T
609 ttctaattttcattgactacacatatttttatttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 698  Q
11968911 ttctaattttcattgactacacatatttttatttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 11969000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 88 - 238
Target Start/End: Complemental strand, 22403471 - 22403318
88 aaaaggacttgcacgaaaattatt-gacaagatgatagcatagggattgatcgatgg----ggaaattatttgtatacaacatgtaaatcaatggaatgt 182  Q
    |||||||||| ||||||||||||| ||||||||||  || |||| ||||||||||||    ||||  |||||||||||||||||| ||||||||||||||    
22403471 aaaaggacttacacgaaaattatttgacaagatgagggcttaggaattgatcgatggacttggaagatatttgtatacaacatgtgaatcaatggaatgt 22403372  T
183 tggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    |||||||| || ||  ||||| | ||   ||||||||||||||| || ||||||||    
22403371 tggagatgtatgct--caaagaccataagaaataataagagaactttttgataagg 22403318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 41341032 - 41341098
11 ggtttgaagaaaacaaaaatgacttaaattagaa-tttgatgaagtgagacaagggataaattagaa 76  Q
    ||||||| |||||| |||||||||||||| |||| ||| ||||||||| ||||| ||||||||||||    
41341032 ggtttgaggaaaacgaaaatgacttaaatcagaattttcatgaagtgaaacaagagataaattagaa 41341098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0413 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0413

Target: scaffold0413; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 37 - 143
Target Start/End: Complemental strand, 8668 - 8562
37 aattagaatttgatgaagtgagacaagggataaattagaagaacatatacg-aaaaggacttgcacgaaaattatt-gacaagatgatagcatagggatt 134  Q
    ||||||||||| ||  |||||||||||  ||||| | |||||||||||| | |||||||||| ||||||||||||| |||||||||||||||||| ||||    
8668 aattagaatttcat--agtgagacaagaaataaaatggaagaacatatatgcaaaaggacttacacgaaaattatttgacaagatgatagcatagagatt 8571  T
135 gatcgatgg 143  Q
    | |||||||    
8570 ggtcgatgg 8562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 143
Target Start/End: Original strand, 10751840 - 10751946
37 aattagaatttgatgaagtgagacaagggataaattagaagaacatatacg-aaaaggacttgcacgaaaattattga-caagatgatagcatagggatt 134  Q
    ||||||||||| ||  |||||||||||  ||||| | |||||||||||| | |||||||||||||| ||||||||| | |||||||||||||||| ||||    
10751840 aattagaatttcat--agtgagacaagaaataaaatggaagaacatatatgcaaaaggacttgcacaaaaattatttaacaagatgatagcatagagatt 10751937  T
135 gatcgatgg 143  Q
    | |||||||    
10751938 ggtcgatgg 10751946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 150 - 244
Target Start/End: Complemental strand, 194501 - 194411
150 tatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataaggaatgat 244  Q
    |||||||||||||||| | ||||||||||| |||||||||| || ||  ||||| |  ||| ||||||||||||| |||||||||| || |||||    
194501 tatttgtatacaacatatgaatcaatggaacgttggagatgtatgct--caaagac--tgggaaataataagagagcattgtgatatgggatgat 194411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 637 - 698
Target Start/End: Complemental strand, 20555113 - 20555050
637 ttatttatttattgttaaaaaca--attcaagctatttcttaatataaaaatttcccttaatta 698  Q
    ||||||||||||||| ||||| |  |||||  |||||||||| ||||| |||||||||||||||    
20555113 ttatttatttattgtaaaaaaaaccattcatcctatttcttactataagaatttcccttaatta 20555050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 238
Target Start/End: Complemental strand, 40458571 - 40458479
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| |||||||||||||||||| || |||||||||| || ||||| || ||  | ||| |||||  |||||||||||||||||||||||||||    
40458571 ggaaaatatttgtatacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatgagaaataataagagaacattgtgataagg 40458479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 3)
Name: chr1

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 238
Target Start/End: Original strand, 43408341 - 43408433
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| |||||||||||||||||| || |||||||||| || ||||| || ||  | ||| |||||  |||||||||||||||||||||||||||    
43408341 ggaaaatatttgtatacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatgagaaataataagagaacattgtgataagg 43408433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 640 - 698
Target Start/End: Original strand, 36387606 - 36387664
640 tttatttattgttaaaaacaattcaagctatttcttaatataaaaatttcccttaatta 698  Q
    |||||||||| ||||||||||||||  |||||||||| ||||| |||||||||||||||    
36387606 tttatttatttttaaaaacaattcatcctatttcttactataagaatttcccttaatta 36387664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 238
Target Start/End: Original strand, 37667732 - 37667824
144 ggaaattatttgtatacaacatgtaaatcaatggaatgttggagatgaattcttacaaaggctatggaaaataataagagaacattgtgataagg 238  Q
    ||||| ||||| | |||||||||| || |||||||||| || ||||| || ||  | ||| |||| |||||||||| ||||||||||||||||||    
37667732 ggaaaatatttttctacaacatgtgaaccaatggaatgatgaagatgtatgct--cgaagactatagaaaataataggagaacattgtgataagg 37667824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98595 times since January 2019
Visitors: 2275