View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9307-LTR4-TNT-insertion-2 (Length: 281)

Name: F9307-LTR4-TNT-insertion-2
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9307-LTR4-TNT-insertion-2
F9307-LTR4-TNT-insertion-2
[»] chr3 (1 HSPs)
chr3 (11-271)||(38719934-38720194)


Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 38720194 - 38719934
Alignment:
11 ccttacaccaacctgtttgcaaaaatcagaaaattagttcctctttcagagattggtcaatattatgcaaaataactgtacacaatgtagaaacttgaca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38720194 ccttacaccaacctgtttgcaaaaatcagaaaattagttcctctttcagagattggtcaatattatgcaaaataactgtacacaatgtagaaacttgaca 38720095  T
111 ggctaatattggattttagtaaattttgataatattgagcaaagtgttttgagaaaaactcaagccccatattaaaaagatataatgtttgaaaattgtt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38720094 ggctaatattggattttagtaaattttgataatattgagcaaagtgttttgagaaaaactcaagccccatattaaaaagatataatgtttgaaaattgtt 38719995  T
211 tataaagaaaaaagaatcattttacaaacagttttgtatgaatgaattaaaactaatatta 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38719994 tataaagaaaaaagaatcattttacaaacagttttgtatgaatgaattaaaactaatatta 38719934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC