View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9307-LTR4-TNT-insertion-3 (Length: 342)

Name: F9307-LTR4-TNT-insertion-3
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9307-LTR4-TNT-insertion-3
F9307-LTR4-TNT-insertion-3
[»] chr4 (9 HSPs)
chr4 (8-332)||(13848391-13848715)
chr4 (23-332)||(13864287-13864596)
chr4 (23-289)||(13870784-13871048)
chr4 (23-102)||(13870267-13870355)
chr4 (48-102)||(13858795-13858849)
chr4 (115-212)||(13556805-13556902)
chr4 (125-214)||(13549855-13549944)
chr4 (112-219)||(13519598-13519705)
chr4 (125-212)||(13563935-13564022)
[»] chr7 (4 HSPs)
chr7 (115-212)||(9690428-9690525)
chr7 (125-214)||(9683477-9683566)
chr7 (112-219)||(9648573-9648680)
chr7 (125-212)||(9697558-9697645)
[»] chr8 (1 HSPs)
chr8 (114-167)||(29736360-29736413)


Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 8 - 332
Target Start/End: Original strand, 13848391 - 13848715
Alignment:
8 catattaggggctcctattactagtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatctcgag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13848391 catattaggggctcctattactagtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatctcgag 13848490  T
108 tccattgtagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaagga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13848491 tccattgtagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaagga 13848590  T
208 acattccgaatgcttcgaaactttatctatgtaactgaacttccccataatatccattttgttattgcatttgcgcaatattatgaagaagtttttcatt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13848591 acattccgaatgcttcgaaactttatctatgtaactgaacttccccataatatccattttgttattgcatttgcgcaatattatgaagaagtttttcatt 13848690  T
308 tataattaagtttgttcttgtatta 332  Q
    |||||||||||||||||||||||||    
13848691 tataattaagtttgttcttgtatta 13848715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 23 - 332
Target Start/End: Original strand, 13864287 - 13864596
Alignment:
23 tattactagtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatctcgagtccattgtagcaaga 122  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13864287 tattactcgtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatctcgagtccattgtagcaaga 13864386  T
123 aaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattccgaatgctt 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13864387 aaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattccgaatgctt 13864486  T
223 cgaaactttatctatgtaactgaacttccccataatatccattttgttattgcatttgcgcaatattatgaagaagtttttcatttataattaagtttgt 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13864487 cgaaactttatctatgtaactgaacttccccataatatccattttgttattgcatttgcgcaatattatgaagaagtttttcatttataattaagtttgt 13864586  T
323 tcttgtatta 332  Q
    ||||||||||    
13864587 tcttgtatta 13864596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 289
Target Start/End: Original strand, 13870784 - 13871048
Alignment:
23 tattactagtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatctcgagtccattgtagcaaga 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    ||||||||||||||||||    
13870784 tattactagtgccaattaaatatgattgaaaggaaatcaacaaccaccaattttagattatataaattaccatatgtagt--gagtccattgtagcaaga 13870881  T
123 aaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattccgaatgctt 222  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
13870882 aaaatggcttcaaagaaaagctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattgcgaatgctt 13870981  T
223 cgaaactttatctatgtaactgaacttccccataatatccattttgttattgcatttgcgcaatatt 289  Q
    |||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
13870982 cgaaaccttatccatgtaagtgaacttccccataatatccattttgttattgcatttgcgcaatatt 13871048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 13870267 - 13870355
Alignment:
23 tattactagtgccaattaaatatgatt---------gaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatc 102  Q
    |||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13870267 tattactagtgccaattaaatatgatttatttacttgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatc 13870355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 13858795 - 13858849
Alignment:
48 ttgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatc 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13858795 ttgaaaggaaatcaacaaccaccaattttggattatataaattaccatatgtatc 13858849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 13556902 - 13556805
Alignment:
115 tagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacatt 212  Q
    ||||||||  ||||||||||||||| ||||| |||||||| || |||||  || ||||| |||||||||||||||||||   ||||||||||||||||    
13556902 tagcaagagtaatggcttcaaagaaatgctcacttatttttgttgttctggttttttgtatgttgagtttttcatcaaatatattagcaaggaacatt 13556805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 13549944 - 13549855
Alignment:
125 aatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattcc 214  Q
    |||||| ||||||| |||||||||||||| ||| |||||| || ||| | ||||||||||||| || || ||| ||||||| ||||||||    
13549944 aatggcatcaaagaggtgctctcttatttgggtggttctcattctttttatgttgagtttttcttccaaagcactagcaagaaacattcc 13549855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 112 - 219
Target Start/End: Complemental strand, 13519705 - 13519598
Alignment:
112 ttgtagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacat 211  Q
    |||||||||||| |||| ||||||||| || ||  || |||| ||  ||||||||| ||||| |||||||||||||  | ||  ||||||||||||||||    
13519705 ttgtagcaagaataatgtcttcaaagaggttcttcctgatttggggggttctctttctttgtgtgttgagtttttctaccaaaccattagcaaggaacat 13519606  T
212 tccgaatg 219  Q
    ||| ||||    
13519605 tcctaatg 13519598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 212
Target Start/End: Complemental strand, 13564022 - 13563935
Alignment:
125 aatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacatt 212  Q
    ||||||||||||||||||||  ||| |||| |||||||||||| ||||| | |||||||||||  | ||  |||||||||| ||||||    
13564022 aatggcttcaaagaagtgcttgcttgtttttgtagttctctttttttgtatcttgagtttttctgccaaaacattagcaagaaacatt 13563935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 9690525 - 9690428
Alignment:
115 tagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacatt 212  Q
    ||||||||  ||||||||||||||| ||||| |||||||| || |||||  || ||||| |||||||||||||||||||   ||||||||||||||||    
9690525 tagcaagagtaatggcttcaaagaaatgctcacttatttttgttgttctggttttttgtatgttgagtttttcatcaaatatattagcaaggaacatt 9690428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 9683566 - 9683477
Alignment:
125 aatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacattcc 214  Q
    |||||| ||||||| |||||||||||||| ||| |||||| || ||| | ||||||||||||| || || ||| ||||||| ||||||||    
9683566 aatggcatcaaagaggtgctctcttatttgggtggttctcattctttttatgttgagtttttcttccaaagcactagcaagaaacattcc 9683477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 112 - 219
Target Start/End: Complemental strand, 9648680 - 9648573
Alignment:
112 ttgtagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacat 211  Q
    |||||||||||| |||| ||||||||| || ||  || |||| ||  ||||||||| ||||| |||||||||||||  | ||  ||||||||||||||||    
9648680 ttgtagcaagaataatgtcttcaaagaggttcttcctgatttggggggttctctttctttgtgtgttgagtttttctaccaaaccattagcaaggaacat 9648581  T
212 tccgaatg 219  Q
    ||| ||||    
9648580 tcctaatg 9648573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 212
Target Start/End: Complemental strand, 9697645 - 9697558
Alignment:
125 aatggcttcaaagaagtgctctcttattttggtagttctctttatttgtctgttgagtttttcatcaaaggcattagcaaggaacatt 212  Q
    ||||||||||||||||||||  ||| |||| |||||||||||| ||||| | |||||||||||  | ||  |||||||||| ||||||    
9697645 aatggcttcaaagaagtgcttgcttgtttttgtagttctctttttttgtatcttgagtttttctgccaaaacattagcaagaaacatt 9697558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 167
Target Start/End: Original strand, 29736360 - 29736413
Alignment:
114 gtagcaagaaaaatggcttcaaagaagtgctctcttattttggtagttctcttt 167  Q
    ||||||||| |||||||||| ||||||||||| ||||||| |||  ||||||||    
29736360 gtagcaagataaatggcttctaagaagtgctcccttatttgggtgattctcttt 29736413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC