View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9307-LTR4-TNT-insertion-4 (Length: 545)

Name: F9307-LTR4-TNT-insertion-4
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9307-LTR4-TNT-insertion-4
[»] chr7 (1 HSPs)
chr7 (8-536)||(29860307-29860835)

Alignment Details
Target: chr7 (Bit Score: 529; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 8 - 536
Target Start/End: Complemental strand, 29860835 - 29860307
8 cctctccatacagagagaggaagcctatatattaacgagtcagtttaaaatgaaaagaaaatccttatatgtttatagcatgtgaagttgtaaaaaagta 107  Q
29860835 cctctccatacagagagaggaagcctatatattaacgagtcagtttaaaatgaaaagaaaatccttatatgtttatagcatgtgaagttgtaaaaaagta 29860736  T
108 aatgaactttaacactgataagtcaagtgtgtttttatgctttgatcaaaatatgttactcatgtaggttggaaaacctgcatgactagatatagccatc 207  Q
29860735 aatgaactttaacactgataagtcaagtgtgtttttatgctttgatcaaaatatgttactcatgtaggttggaaaacctgcatgactagatatagccatc 29860636  T
208 ataaagaaggaaatttatcgacctagcaagccaataatccaataataatcagcataatcttcaaagggataaactagatataatgttatcaatcaacaat 307  Q
29860635 ataaagaaggaaatttatcgacctagcaagccaataatccaataataatcagcataatcttcaaagggataaactagatataatgttatcaatcaacaat 29860536  T
308 gagaaagaaaagatttaaatctatatcctctgtggatattcccaacaatcgaaattggaaggggtgataaactatctaagccatttggtaatgcttcaaa 407  Q
29860535 gagaaagaaaagatttaaatctatatcctctgtggatattcccaacaatcgaaattggaaggggtgataaactatctaagccatttggtaatgcttcaaa 29860436  T
408 gcccatttggtaaaacaatcttattctaattcacatatgttgtctttggcttgaccatgaaatcaaaatatgatgattcaatacaagtgtcttctatgcc 507  Q
29860435 gcccatttggtaaaacaatcttattctaattcacatatgttgtctttggcttgaccatgaaatcaaaatatgatgattcaatacaagtgtcttctatgcc 29860336  T
508 accaagtatgtaatcaaacacaacaattg 536  Q
29860335 accaagtatgtaatcaaacacaacaattg 29860307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105504 times since January 2019
Visitors: 2328