View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9307-LTR4-TNT-insertion-4 (Length: 545)

Name: F9307-LTR4-TNT-insertion-4
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9307-LTR4-TNT-insertion-4
F9307-LTR4-TNT-insertion-4
[»] chr7 (1 HSPs)
chr7 (8-536)||(29860307-29860835)


Alignment Details
Target: chr7 (Bit Score: 529; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 8 - 536
Target Start/End: Complemental strand, 29860835 - 29860307
Alignment:
8 cctctccatacagagagaggaagcctatatattaacgagtcagtttaaaatgaaaagaaaatccttatatgtttatagcatgtgaagttgtaaaaaagta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29860835 cctctccatacagagagaggaagcctatatattaacgagtcagtttaaaatgaaaagaaaatccttatatgtttatagcatgtgaagttgtaaaaaagta 29860736  T
108 aatgaactttaacactgataagtcaagtgtgtttttatgctttgatcaaaatatgttactcatgtaggttggaaaacctgcatgactagatatagccatc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29860735 aatgaactttaacactgataagtcaagtgtgtttttatgctttgatcaaaatatgttactcatgtaggttggaaaacctgcatgactagatatagccatc 29860636  T
208 ataaagaaggaaatttatcgacctagcaagccaataatccaataataatcagcataatcttcaaagggataaactagatataatgttatcaatcaacaat 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29860635 ataaagaaggaaatttatcgacctagcaagccaataatccaataataatcagcataatcttcaaagggataaactagatataatgttatcaatcaacaat 29860536  T
308 gagaaagaaaagatttaaatctatatcctctgtggatattcccaacaatcgaaattggaaggggtgataaactatctaagccatttggtaatgcttcaaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29860535 gagaaagaaaagatttaaatctatatcctctgtggatattcccaacaatcgaaattggaaggggtgataaactatctaagccatttggtaatgcttcaaa 29860436  T
408 gcccatttggtaaaacaatcttattctaattcacatatgttgtctttggcttgaccatgaaatcaaaatatgatgattcaatacaagtgtcttctatgcc 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29860435 gcccatttggtaaaacaatcttattctaattcacatatgttgtctttggcttgaccatgaaatcaaaatatgatgattcaatacaagtgtcttctatgcc 29860336  T
508 accaagtatgtaatcaaacacaacaattg 536  Q
    |||||||||||||||||||||||||||||    
29860335 accaagtatgtaatcaaacacaacaattg 29860307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC