View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9307-LTR4-TNT-insertion-5 (Length: 317)

Name: F9307-LTR4-TNT-insertion-5
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9307-LTR4-TNT-insertion-5
F9307-LTR4-TNT-insertion-5
[»] chr1 (1 HSPs)
chr1 (8-308)||(42891725-42892025)


Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 8 - 308
Target Start/End: Original strand, 42891725 - 42892025
Alignment:
8 atcgtgattatgaacctatccacaatccaattttcaatattatgttttttctgttaatcattatattaaactaaatcctgttgtgattagtattttttaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42891725 atcgtgattatgaacctatccacaatccaattttcaatattatgttttttctgttaatcattatattaaactaaatcctgttgtgattagtattttttaa 42891824  T
108 ttcataatctcagatgtcatacttctgtttttactaactattgtttacgttgtgtgcatttaattttttccttggcttaatctctttctgtggtttgata 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42891825 ttcataatctcagatgtcatacttctgtttttactaactattgtttacgttgtgtgcatttaattttttccttggcttaatctctttctgtggtttgata 42891924  T
208 ggcattgggttatgtgcatggagctcaagttgtccatgcatctgaaccagttcacgggcgtctgaggtatgcttgatcattttaaaaacattgtgtaatt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42891925 ggcattgggttatgtgcatggagctcaagttgtccatgcatctgaaccagttcacgggcgtctgaggtatgcttgatcattttaaaaacattgtgtaatt 42892024  T
308 g 308  Q
    |    
42892025 g 42892025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84213 times since January 2019
Visitors: 2323