View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9308-LTR4-TNT-insertion-1 (Length: 356)

Name: F9308-LTR4-TNT-insertion-1
Description: F9308-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9308-LTR4-TNT-insertion-1
F9308-LTR4-TNT-insertion-1
[»] chr1 (3 HSPs)
chr1 (9-346)||(10921759-10922096)
chr1 (105-185)||(11000161-11000238)
chr1 (105-185)||(11003138-11003215)


Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 9 - 346
Target Start/End: Original strand, 10921759 - 10922096
Alignment:
9 gcacgataccacaaccgtctgccagccccgaatccgaaaaagtttcgttttctccaatataattgacgtagaacgaattccctggttgctcatatgtact 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10921759 gcacgataccacaaccgtctgccagccccgaatccgaaaaagtttcgttttctccaatataattgacgtagaacgaattccctggttgctcatatgtact 10921858  T
109 aatgttcatacaggccggagaagcaaagtaaataccagaagaatattggacatgattcggacatctcatatataacacaggctttgccaataatatattg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10921859 aatgttcatacaggccggagaagcaaagtaaataccagaagaatattggacatgattcggacatctcatatataacacaggctttgccaataatatattg 10921958  T
209 tacacatacatttcgtacggcaagcttatggaatatgtgtaagtgaaattatagaggcctagtgaatggggagggagggtaaaattagagtaaccaaaat 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10921959 tacacatacatttcgtacggcaagcttatggaatatgtgtaagtgaaattatagaggcctagtgaatggggagggagggtaaaattagagtaaccaaaat 10922058  T
309 tgacatccaacagtcgtatagtgtagttgttgtaatta 346  Q
    |||||||||| |||||||||||||||||||||||||||    
10922059 tgacatccaatagtcgtatagtgtagttgttgtaatta 10922096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 185
Target Start/End: Complemental strand, 11000238 - 11000161
Alignment:
105 tactaatgttcatacaggccggagaagcaaagtaaataccagaagaatattggacatgattcggacatctcatatataaca 185  Q
    |||||||||||||||| ||   || | ||||||||||||| ||||||||||||||||| || |||||| ||| ||||||||    
11000238 tactaatgttcatacaagc---agcatcaaagtaaatacctgaagaatattggacatgtttaggacatgtcacatataaca 11000161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 185
Target Start/End: Complemental strand, 11003215 - 11003138
Alignment:
105 tactaatgttcatacaggccggagaagcaaagtaaataccagaagaatattggacatgattcggacatctcatatataaca 185  Q
    |||||||||||||||| ||   || | ||||||||||||| ||||||||||||||||| || |||||| ||| ||||||||    
11003215 tactaatgttcatacaagc---agcatcaaagtaaatacctgaagaatattggacatgtttgggacatgtcacatataaca 11003138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC