View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9309-LTR4-TNT-insertion-2 (Length: 393)

Name: F9309-LTR4-TNT-insertion-2
Description: F9309-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9309-LTR4-TNT-insertion-2
F9309-LTR4-TNT-insertion-2
[»] chr7 (7 HSPs)
chr7 (10-383)||(25600672-25601045)
chr7 (29-64)||(1432061-1432096)
chr7 (29-87)||(5939025-5939086)
chr7 (32-91)||(39591532-39591593)
chr7 (29-84)||(49060481-49060538)
chr7 (27-64)||(28178908-28178945)
chr7 (29-84)||(33894564-33894620)
[»] chr4 (8 HSPs)
chr4 (225-287)||(48587276-48587338)
chr4 (29-65)||(24936251-24936287)
chr4 (31-64)||(49219082-49219115)
chr4 (296-336)||(48587036-48587076)
chr4 (29-84)||(24443979-24444036)
chr4 (29-83)||(19422359-19422415)
chr4 (29-65)||(23815311-23815347)
chr4 (29-65)||(28623230-28623266)
[»] chr3 (12 HSPs)
chr3 (31-91)||(53736178-53736240)
chr3 (34-83)||(54775074-54775125)
chr3 (29-63)||(39743846-39743880)
chr3 (29-84)||(43116500-43116557)
chr3 (32-88)||(20143869-20143926)
chr3 (32-88)||(23269263-23269320)
chr3 (31-64)||(34318031-34318064)
chr3 (29-62)||(36887463-36887496)
chr3 (33-65)||(10357378-10357410)
chr3 (32-64)||(16790182-16790214)
chr3 (28-64)||(33882968-33883004)
chr3 (32-64)||(48588609-48588641)
[»] chr6 (9 HSPs)
chr6 (29-84)||(10452432-10452489)
chr6 (34-83)||(5328920-5328971)
chr6 (29-65)||(33068654-33068690)
chr6 (29-64)||(24836293-24836328)
chr6 (29-64)||(32975919-32975954)
chr6 (30-64)||(31672012-31672046)
chr6 (29-62)||(5554861-5554894)
chr6 (23-63)||(4247156-4247196)
chr6 (29-84)||(27889916-27889972)
[»] chr8 (6 HSPs)
chr8 (29-62)||(31884535-31884568)
chr8 (29-84)||(35869778-35869835)
chr8 (26-64)||(40728512-40728550)
chr8 (32-86)||(2699250-2699306)
chr8 (31-64)||(26820142-26820175)
chr8 (29-86)||(11188225-11188284)
[»] scaffold0019 (1 HSPs)
scaffold0019 (29-65)||(104227-104263)
[»] chr5 (5 HSPs)
chr5 (29-65)||(29588821-29588857)
chr5 (29-84)||(35135734-35135791)
chr5 (29-87)||(37063143-37063203)
chr5 (32-64)||(10537769-10537801)
chr5 (29-84)||(18704108-18704164)
[»] chr2 (7 HSPs)
chr2 (28-64)||(44216859-44216895)
chr2 (29-64)||(3673748-3673783)
chr2 (29-84)||(10143113-10143170)
chr2 (29-83)||(3102634-3102690)
chr2 (32-64)||(1939426-1939458)
chr2 (28-60)||(7193950-7193982)
chr2 (32-64)||(44439454-44439486)
[»] scaffold0103 (1 HSPs)
scaffold0103 (29-64)||(51509-51544)
[»] chr1 (7 HSPs)
chr1 (26-64)||(43333637-43333675)
chr1 (30-64)||(49517012-49517046)
chr1 (30-64)||(49557083-49557117)
chr1 (29-99)||(27140426-27140498)
chr1 (27-64)||(52559922-52559959)
chr1 (32-76)||(7707163-7707207)
chr1 (32-64)||(36641819-36641851)
[»] scaffold0508 (1 HSPs)
scaffold0508 (29-62)||(9871-9904)


Alignment Details
Target: chr7 (Bit Score: 374; Significance: 0; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 10 - 383
Target Start/End: Original strand, 25600672 - 25601045
Alignment:
10 acaagggcatgaatgtttcatgtataagttatttctataacaaaatataaaataatcaaacaatttttatataagttgtttttatcagctcttttaaact 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25600672 acaagggcatgaatgtttcatgtataagttatttctataacaaaatataaaataatcaaacaatttttatataagttgtttttatcagctcttttaaact 25600771  T
110 gtcttaaaagtgattactcgataagtgcttgtaaacctttgatagtaatttcaacttaagattaaggcatgaacctcaacaagaaaaatcattcatctgc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25600772 gtcttaaaagtgattactcgataagtgcttgtaaacctttgatagtaatttcaacttaagattaaggcatgaacctcaacaagaaaaatcattcatctgc 25600871  T
210 ctatcacacaaaatcctatccaccacccccttactattattactcttctcaacctcagtttctgatgccacaaccacatcctcctcaaggtaaggagtga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25600872 ctatcacacaaaatcctatccaccacccccttactattattactcttctcaacctcagtttctgatgccacaaccacatcctcctcaaggtaaggagtga 25600971  T
310 tgtgaacttgcataaacacactttgcactccactagaatcttaacaatctcgatcaccaaatccacttggatta 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25600972 tgtgaacttgcataaacacactttgcactccactagaatcttaacaatctcgatcaccaaatccacttggatta 25601045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 64
Target Start/End: Complemental strand, 1432096 - 1432061
Alignment:
29 atgtataagttatttctataacaaaatataaaataa 64  Q
    |||||||||||||||||||||||||| |||||||||    
1432096 atgtataagttatttctataacaaaagataaaataa 1432061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 87
Target Start/End: Original strand, 5939025 - 5939086
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaa-tttttatataagttg 87  Q
    ||||||||||||||| |||||||||| || ||||||  |||||||| |||||||||||||||    
5939025 atgtataagttatttttataacaaaaaattaaataaagtcaaacaattttttatataagttg 5939086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 91
Target Start/End: Complemental strand, 39591593 - 39591532
Alignment:
32 tataagttatttctataacaaaatataaaataa--tcaaacaatttttatataagttgtttt 91  Q
    ||||||||||||||||||||||| |||||||||  |||||   |||| ||||||||||||||    
39591593 tataagttatttctataacaaaagataaaataaagtcaaattgttttcatataagttgtttt 39591532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 49060481 - 49060538
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataag 84  Q
    ||||||||| |||||||||||||||| |||||||||  |||||  |||||||||||||    
49060481 atgtataagctatttctataacaaaaaataaaataaagtcaaattatttttatataag 49060538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 28178908 - 28178945
Alignment:
27 tcatgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||| |||||||||||||||| |||||||||    
28178908 tcatgtataagctatttctataacaaaagataaaataa 28178945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 33894564 - 33894620
Alignment:
29 atgtataagttatttctataacaaaatataaaataa-tcaaacaatttttatataag 84  Q
    ||||||||| |||||||||||||||| ||||||||| ||||||  |||| |||||||    
33894564 atgtataagctatttctataacaaaagataaaataagtcaaactgttttcatataag 33894620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 225 - 287
Target Start/End: Complemental strand, 48587338 - 48587276
Alignment:
225 ctatccaccacccccttactattattactcttctcaacctcagtttctgatgccacaaccaca 287  Q
    |||||||||||| ||||||||||||||||||||||| ||||||  | |||||||||| |||||    
48587338 ctatccaccacctccttactattattactcttctcagcctcagcctttgatgccacagccaca 48587276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 24936251 - 24936287
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    |||||||||||||||||||||||||||||||||||||    
24936251 atgtataagttatttctataacaaaatataaaataat 24936287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 49219082 - 49219115
Alignment:
31 gtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||||||||||||||    
49219082 gtataagttatttctataacaaaatataaaataa 49219115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 336
Target Start/End: Complemental strand, 48587076 - 48587036
Alignment:
296 aaggtaaggagtgatgtgaacttgcataaacacactttgca 336  Q
    |||||||||| ||||||||||||||||||||||||| ||||    
48587076 aaggtaaggaatgatgtgaacttgcataaacacactctgca 48587036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 24443979 - 24444036
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataag 84  Q
    |||||||||  ||||||| |||||||||||||||||  |||||||||||| |||||||    
24443979 atgtataagcgatttctacaacaaaatataaaataaattcaaacaattttcatataag 24444036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 19422359 - 19422415
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataa 83  Q
    |||||||||||||||||||||||||| ||| |||||  ||||||| |||| ||||||    
19422359 atgtataagttatttctataacaaaagatataataaagtcaaacatttttcatataa 19422415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 23815311 - 23815347
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    |||| ||||||||||||||||||||| ||||||||||    
23815311 atgtttaagttatttctataacaaaagataaaataat 23815347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 28623230 - 28623266
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    ||||||||||||||| |||||||||| ||||||||||    
28623230 atgtataagttatttatataacaaaagataaaataat 28623266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 53736240 - 53736178
Alignment:
31 gtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataagttgtttt 91  Q
    |||| ||||||||||||||||||| |||||||||  |||||| ||||| ||||||||||||||    
53736240 gtatgagttatttctataacaaaagataaaataatgtcaaactattttcatataagttgtttt 53736178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 83
Target Start/End: Original strand, 54775074 - 54775125
Alignment:
34 taagttatttctataacaaaatataaaataa--tcaaacaatttttatataa 83  Q
    ||||||||||||||||||||| |||||||||  |||||| ||||||||||||    
54775074 taagttatttctataacaaaagataaaataaagtcaaaccatttttatataa 54775125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 63
Target Start/End: Original strand, 39743846 - 39743880
Alignment:
29 atgtataagttatttctataacaaaatataaaata 63  Q
    |||||||||||||||| ||||||||||||||||||    
39743846 atgtataagttatttcaataacaaaatataaaata 39743880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 43116557 - 43116500
Alignment:
29 atgtataagttatttctataacaaaatataaaat--aatcaaacaatttttatataag 84  Q
    |||| |||| |||||||||||||||| |||||||  |||||||||||||| |||||||    
43116557 atgtgtaagctatttctataacaaaagataaaatcaaatcaaacaattttcatataag 43116500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 88
Target Start/End: Original strand, 20143869 - 20143926
Alignment:
32 tataagttatttctataacaaaatataaaataa-tcaaacaatttttatataagttgt 88  Q
    |||||||||||||||||| |||| ||||||||| |||||| ||||| |||||| ||||    
20143869 tataagttatttctataataaaagataaaataagtcaaactattttcatataacttgt 20143926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 88
Target Start/End: Complemental strand, 23269320 - 23269263
Alignment:
32 tataagttatttctataacaaaatataaaataa-tcaaacaatttttatataagttgt 88  Q
    |||||||||||||||||| |||| ||||||||| |||||| ||||| |||||| ||||    
23269320 tataagttatttctataataaaagataaaataagtcaaactattttcatataacttgt 23269263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 34318031 - 34318064
Alignment:
31 gtataagttatttctataacaaaatataaaataa 64  Q
    ||||||| ||||||||||||||||||||||||||    
34318031 gtataagctatttctataacaaaatataaaataa 34318064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 62
Target Start/End: Original strand, 36887463 - 36887496
Alignment:
29 atgtataagttatttctataacaaaatataaaat 62  Q
    |||||||||||||||||||||||||| |||||||    
36887463 atgtataagttatttctataacaaaagataaaat 36887496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 65
Target Start/End: Original strand, 10357378 - 10357410
Alignment:
33 ataagttatttctataacaaaatataaaataat 65  Q
    |||||||||||||||||||||| ||||||||||    
10357378 ataagttatttctataacaaaagataaaataat 10357410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 16790214 - 16790182
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||| |||||||||    
16790214 tataagttatttctataacaaaagataaaataa 16790182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 33882968 - 33883004
Alignment:
28 catgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||| ||||||||||||||||| |||||||||    
33882968 catgtataaattatttctataacaaaagataaaataa 33883004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Original strand, 48588609 - 48588641
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    |||||||||||||||||| ||||||||||||||    
48588609 tataagttatttctataataaaatataaaataa 48588641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 10452489 - 10452432
Alignment:
29 atgtataagttatttctataacaaaatataaaat--aatcaaacaatttttatataag 84  Q
    ||||||||| ||||||||||||||||||||||||  |||||||| ||||| |||||||    
10452489 atgtataagctatttctataacaaaatataaaataaaatcaaactattttcatataag 10452432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 83
Target Start/End: Original strand, 5328920 - 5328971
Alignment:
34 taagttatttctataacaaaatataaaataa--tcaaacaatttttatataa 83  Q
    ||||||||||||||||||||| |||||||||  |||||| ||||||||||||    
5328920 taagttatttctataacaaaagataaaataaagtcaaaccatttttatataa 5328971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 33068690 - 33068654
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    |||||||||||||||||||||||||| ||||||||||    
33068690 atgtataagttatttctataacaaaagataaaataat 33068654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 64
Target Start/End: Complemental strand, 24836328 - 24836293
Alignment:
29 atgtataagttatttctataacaaaatataaaataa 64  Q
    |||||||||||||||||||||||||| |||||||||    
24836328 atgtataagttatttctataacaaaagataaaataa 24836293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 64
Target Start/End: Original strand, 32975919 - 32975954
Alignment:
29 atgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||| ||||||||||||||||||    
32975919 atgtataagttatttctgtaacaaaatataaaataa 32975954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 31672012 - 31672046
Alignment:
30 tgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||||| |||||||||    
31672012 tgtataagttatttctataacaaaagataaaataa 31672046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 62
Target Start/End: Complemental strand, 5554894 - 5554861
Alignment:
29 atgtataagttatttctataacaaaatataaaat 62  Q
    |||||||||||||||||||||||||| |||||||    
5554894 atgtataagttatttctataacaaaagataaaat 5554861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 4247196 - 4247156
Alignment:
23 tgtttcatgtataagttatttctataacaaaatataaaata 63  Q
    |||||||||| |||| |||||||||||||||| ||||||||    
4247196 tgtttcatgtgtaagctatttctataacaaaagataaaata 4247156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 27889972 - 27889916
Alignment:
29 atgtataagttatttctataacaaaatataaaataa-tcaaacaatttttatataag 84  Q
    ||||| |||||||||||||||||| | ||||||||| |||||| ||||| |||||||    
27889972 atgtacaagttatttctataacaacagataaaataattcaaactattttcatataag 27889916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 29 - 62
Target Start/End: Original strand, 31884535 - 31884568
Alignment:
29 atgtataagttatttctataacaaaatataaaat 62  Q
    ||||||||||||||||||||||||||||||||||    
31884535 atgtataagttatttctataacaaaatataaaat 31884568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 35869778 - 35869835
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataag 84  Q
    |||||||||  ||||||| |||||||||||||||||  |||||||||||| |||||||    
35869778 atgtataagcgatttctacaacaaaatataaaataaattcaaacaattttcatataag 35869835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 40728550 - 40728512
Alignment:
26 ttcatgtataagttatttctataacaaaatataaaataa 64  Q
    |||||| |||||||||||||||||||||| |||||||||    
40728550 ttcatgcataagttatttctataacaaaagataaaataa 40728512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 2699250 - 2699306
Alignment:
32 tataagttatttctataacaaaatataaaataa--tcaaacaatttttatataagtt 86  Q
    ||||||||||||||| |||||||||||||||||  | |||| ||||| |||||||||    
2699250 tataagttatttctacaacaaaatataaaataaagttaaactattttcatataagtt 2699306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 26820142 - 26820175
Alignment:
31 gtataagttatttctataacaaaatataaaataa 64  Q
    |||||||||||||||||||||||| |||||||||    
26820142 gtataagttatttctataacaaaagataaaataa 26820175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Complemental strand, 11188284 - 11188225
Alignment:
29 atgtataagttatttctataacaaaatataaaat--aatcaaacaatttttatataagtt 86  Q
    ||||||||||| |||||||||||||| |||||||  || ||||| |||||||||| ||||    
11188284 atgtataagttgtttctataacaaaagataaaataaaaccaaactatttttatattagtt 11188225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 104263 - 104227
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    |||||||||||||||||||||||||| ||||||||||    
104263 atgtataagttatttctataacaaaaaataaaataat 104227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 29588821 - 29588857
Alignment:
29 atgtataagttatttctataacaaaatataaaataat 65  Q
    ||||||||| |||||||||||||||||||||||||||    
29588821 atgtataagctatttctataacaaaatataaaataat 29588857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 35135791 - 35135734
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataag 84  Q
    ||||||||| |||||||||||||||| |||||||||  |||||| ||||| |||||||    
35135791 atgtataagatatttctataacaaaagataaaataaagtcaaactattttcatataag 35135734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 87
Target Start/End: Complemental strand, 37063203 - 37063143
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataagttg 87  Q
    ||||||||  |||||||||||||||| |||||||||  |||||| ||||| ||||||||||    
37063203 atgtataaactatttctataacaaaagataaaataaagtcaaactattttcatataagttg 37063143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 10537801 - 10537769
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||| |||||||||||    
10537801 tataagttatttctataacaagatataaaataa 10537769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 18704164 - 18704108
Alignment:
29 atgtataagttatttctataacaaaatataaa-ataatcaaacaatttttatataag 84  Q
    |||||||||||||||||||||||||| ||||| | | |||| | |||||||||||||    
18704164 atgtataagttatttctataacaaaagataaataaagtcaagctatttttatataag 18704108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 44216859 - 44216895
Alignment:
28 catgtataagttatttctataacaaaatataaaataa 64  Q
    |||||||||||||||| ||||||||||||||||||||    
44216859 catgtataagttatttttataacaaaatataaaataa 44216895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 64
Target Start/End: Original strand, 3673748 - 3673783
Alignment:
29 atgtataagttatttctataacaaaatataaaataa 64  Q
    |||||| |||||||||||||||||||||||||||||    
3673748 atgtattagttatttctataacaaaatataaaataa 3673783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 10143113 - 10143170
Alignment:
29 atgtataagttatttctataacaaaatataaaat--aatcaaacaatttttatataag 84  Q
    |||||||||||||||||||||||||| |||||||  | ||||||  ||||||||||||    
10143113 atgtataagttatttctataacaaaagataaaattaagtcaaactgtttttatataag 10143170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 3102634 - 3102690
Alignment:
29 atgtataagttatttctataacaaaatataaaataa--tcaaacaatttttatataa 83  Q
    ||||||||| ||||| |||| |||||||||||||||  |||||| ||||||||||||    
3102634 atgtataagctatttttatagcaaaatataaaataaagtcaaactatttttatataa 3102690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 1939458 - 1939426
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||| |||||||||    
1939458 tataagttatttctataacaaaagataaaataa 1939426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 60
Target Start/End: Complemental strand, 7193982 - 7193950
Alignment:
28 catgtataagttatttctataacaaaatataaa 60  Q
    |||||||||| ||||||||||||||||||||||    
7193982 catgtataagctatttctataacaaaatataaa 7193950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 44439486 - 44439454
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||| |||||||||||||||||||    
44439486 tataagttatttccataacaaaatataaaataa 44439454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0103 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0103
Description:

Target: scaffold0103; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 64
Target Start/End: Original strand, 51509 - 51544
Alignment:
29 atgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||| ||||||||||||||||||||    
51509 atgtataagttatttttataacaaaatataaaataa 51544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 64
Target Start/End: Original strand, 43333637 - 43333675
Alignment:
26 ttcatgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||| || ||||||||||||||    
43333637 ttcatgtataagttatttctagaagaaaatataaaataa 43333675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 49517012 - 49517046
Alignment:
30 tgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||||| |||||||||    
49517012 tgtataagttatttctataacaaaagataaaataa 49517046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 49557083 - 49557117
Alignment:
30 tgtataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||||| |||||||||    
49557083 tgtataagttatttctataacaaaagataaaataa 49557117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 99
Target Start/End: Original strand, 27140426 - 27140498
Alignment:
29 atgtataagttatttctataacaaaatataaaata--atcaaacaatttttatataagttgtttttatcagct 99  Q
    |||| ||||||||||||||||||||| ||||||||  || |||   |||||||||||| ||||||||| ||||    
27140426 atgtgtaagttatttctataacaaaagataaaataatattaaattgtttttatataagctgtttttataagct 27140498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Complemental strand, 52559959 - 52559922
Alignment:
27 tcatgtataagttatttctataacaaaatataaaataa 64  Q
    |||||||||| |||| ||||||||||||||||||||||    
52559959 tcatgtataaattatatctataacaaaatataaaataa 52559922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 76
Target Start/End: Original strand, 7707163 - 7707207
Alignment:
32 tataagttatttctataacaaaatataaaataatcaaacaatttt 76  Q
    ||||||||||||| ||||||||| |||||||| |||||| |||||    
7707163 tataagttatttcgataacaaaagataaaatagtcaaactatttt 7707207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Original strand, 36641819 - 36641851
Alignment:
32 tataagttatttctataacaaaatataaaataa 64  Q
    ||||||||||||||||||||||| |||||||||    
36641819 tataagttatttctataacaaaagataaaataa 36641851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0508 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0508
Description:

Target: scaffold0508; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 62
Target Start/End: Complemental strand, 9904 - 9871
Alignment:
29 atgtataagttatttctataacaaaatataaaat 62  Q
    |||||||||||||||||||||||||| |||||||    
9904 atgtataagttatttctataacaaaaaataaaat 9871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC