View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9309-LTR4-TNT-insertion-3 (Length: 816)

Name: F9309-LTR4-TNT-insertion-3
Description: F9309-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9309-LTR4-TNT-insertion-3
F9309-LTR4-TNT-insertion-3
[»] chr4 (7 HSPs)
chr4 (6-816)||(43274539-43275349)
chr4 (451-816)||(43267274-43267639)
chr4 (451-816)||(43287075-43287440)
chr4 (63-433)||(43268032-43268402)
chr4 (24-306)||(43310750-43311032)
chr4 (463-784)||(43307903-43308224)
chr4 (323-431)||(43310598-43310706)


Alignment Details
Target: chr4 (Bit Score: 786; Significance: 0; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 786; E-Value: 0
Query Start/End: Original strand, 6 - 816
Target Start/End: Complemental strand, 43275349 - 43274539
Alignment:
6 cactattcttctaaatcattacctgtgaatataagtgaattagcctccaaaattactaatgatatagtttgtagggttgctttaggaagaaaatatgatg 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43275349 cactattcttctaaatcattacctgtgaatataagtgaattagcctccaaaattactaatgatatagtttgtagggttgctttaggaagaaaatatgatg 43275250  T
106 gtgaaagtggaaagggatttaagaagttgttgagggaatttaacgagtcacttagtgcttttattgttggagcctatgttccttggcttgattgggtgac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43275249 gtgaaagtggaaagggatttaagaagttgttgagggaatttaacgagtcacttagtgcttttattgttggagcctatgttccttggcttgattgggtgac 43275150  T
206 ccatgtttctggattttatgcaagagcnnnnnnngtggctaaacaatttgatgaacttttggaagatgtagttgaagatcatatcaatcgtcagaaagga 305  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43275149 ccatgtttctggattttatgcaagagcaaaaaaagtggctaaacaatttgatgaacttttggaagatgtagttgaagatcatatcaatcgtcagaaagga 43275050  T
306 gtcaatgaagaccatgatgactttgttgatgttttgctttggatccaaaagacagaatcacttggctttcctattgatagaacaattataaaagctctcc 405  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43275049 gtcaatgaagaccatgatgactttgttgatgttttgctttggatccaaaagacagaatcacttggctttcctattgatagaacaattataaaagctctcc 43274950  T
406 tattggtaagtgtaaaattaaaatctctttgttaccctttgaatcttatgcaaattttattgaccatgtatttgtttatatttaggacatgtttattgga 505  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43274949 tattggtaagtgtaaaattaaaatctctttgttaccctttgaatcttatgcaaattttattgaccatgtatttgtttatatttaggacatgtttattgga 43274850  T
506 ggtacagacaccatatccagtttgctagagtgggaaatgactgaactcataaggcatccaaatatcatgaagaaattgcaagaagaagcaaggttggtgg 605  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43274849 ggtacagacaccatatccagtttgctagagtgggaaatgactgaactcataaggcatccaaatatcatgaagaaattgcaagaagaagcaaggttggtgg 43274750  T
606 ctaatggtagaaaacacataactgaagaagatttgagtcacatgaactacttaagggcagtggttaaagaaaccctacgtttacatcctccatttccatt 705  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
43274749 ctaatggtagaaaacacataactgaagaagatttgagtcacatgaactacttaaaggcagtggttaaagaaaccctacgtttacatcctccatttccatt 43274650  T
706 actagtcccaagagtaaacacacaagatatcaaattaaatggttaccacattaaagctggcacacatgttattatcaataattggagcatagcaagagac 805  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43274649 actagtcccaagagtaaacacacaagatatcaaattaaatggttaccacattaaagctggcacacatgttattatcaataattggagcatagcaagagac 43274550  T
806 cctacaaattg 816  Q
    |||||||||||    
43274549 cctacaaattg 43274539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 451 - 816
Target Start/End: Complemental strand, 43267639 - 43267274
Alignment:
451 ttatgcaaattttattgaccatgtatttgtttatatttaggacatgtttattggaggtacagacaccatatccagtttgctagagtgggaaatgactgaa 550  Q
    |||||||||||||||||||||| ||||||||| |||| ||||||||||||||| |||||||||||||||||||| |||||||||||||  |||||| |||    
43267639 ttatgcaaattttattgaccatatatttgtttctattcaggacatgtttattgcaggtacagacaccatatccactttgctagagtggtcaatgacagaa 43267540  T
551 ctcataaggcatccaaatatcatgaagaaattgcaagaagaagcaaggttggtggctaatggtagaaaacacataactgaagaagatttgagtcacatga 650  Q
    ||| || ||||||||||||||||||| |||||||||||||||| || |   |||||||||||||||| ||||||||||||||||||||| ||||||||||    
43267539 ctcttacggcatccaaatatcatgaaaaaattgcaagaagaagtaaagagagtggctaatggtagaacacacataactgaagaagatttaagtcacatga 43267440  T
651 actacttaagggcagtggttaaagaaaccctacgtttacatcctccatttccattactagtcccaagagtaaacacacaagatatcaaattaaatggtta 750  Q
    | |||||||  ||||| ||||||||||||||||||||||||||  || ||||||||||||| ||||||| || || ||||||||||||| |||||||  |    
43267439 aatacttaaatgcagtagttaaagaaaccctacgtttacatccctcaattccattactagtaccaagagaaagcagacaagatatcaaactaaatggaca 43267340  T
751 ccacattaaagctggcacacatgttattatcaataattggagcatagcaagagaccctacaaattg 816  Q
    |||||| |||||||||||||  ||| ||||||||  ||||  ||| |||||||| |||||| ||||    
43267339 ccacatcaaagctggcacacgagtttttatcaatgcttgggccattgcaagagatcctacacattg 43267274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 451 - 816
Target Start/End: Complemental strand, 43287440 - 43287075
Alignment:
451 ttatgcaaattttattgaccatgtatttgtttatatttaggacatgtttattggaggtacagacaccatatccagtttgctagagtgggaaatgactgaa 550  Q
    |||||||||||||||||||||| ||||||||| |||| ||||||||||||||| |||||||||||||||||||| |||||||||||||  |||||| |||    
43287440 ttatgcaaattttattgaccatatatttgtttctattcaggacatgtttattgcaggtacagacaccatatccactttgctagagtggtcaatgacagaa 43287341  T
551 ctcataaggcatccaaatatcatgaagaaattgcaagaagaagcaaggttggtggctaatggtagaaaacacataactgaagaagatttgagtcacatga 650  Q
    ||| || ||||||||||||||||||| |||||||||||||||| || |   |||||||||||||||| ||||||||||||||||||||| ||||||||||    
43287340 ctcttacggcatccaaatatcatgaaaaaattgcaagaagaagtaaagagagtggctaatggtagaacacacataactgaagaagatttaagtcacatga 43287241  T
651 actacttaagggcagtggttaaagaaaccctacgtttacatcctccatttccattactagtcccaagagtaaacacacaagatatcaaattaaatggtta 750  Q
    | |||||||  ||||| ||||||||||||||||||||||||||  || ||||||||||||| ||||||| || || ||||||||||||| |||||||  |    
43287240 aatacttaaatgcagtagttaaagaaaccctacgtttacatccctcaattccattactagtaccaagagaaagcagacaagatatcaaactaaatggaca 43287141  T
751 ccacattaaagctggcacacatgttattatcaataattggagcatagcaagagaccctacaaattg 816  Q
    |||||| |||||||||||||  ||| ||||||||  ||||  ||| |||||||| |||||| ||||    
43287140 ccacatcaaagctggcacacgagtttttatcaatgcttgggccattgcaagagatcctacacattg 43287075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 142; E-Value: 4e-74
Query Start/End: Original strand, 63 - 433
Target Start/End: Complemental strand, 43268402 - 43268032
Alignment:
63 aatgatatagtttgtagggttgctttaggaagaaaatatgatggtgaaagtggaaagggatttaagaagttgttgagggaatttaacgagtcacttagtg 162  Q
    |||||||||||||||||||||| ||| |||||||| |||  |||||||| ||| |||||||||   ||||| |||| ||| ||||  |||| |||| |||    
43268402 aatgatatagtttgtagggttgttttgggaagaaagtatagtggtgaaaatgggaagggattttcaaagttattgatggattttactgagttacttggtg 43268303  T
163 cttttattgttggagcctatgttccttggcttgattgggtgacccatgtttctggattttatgcaagagcnnnnnnngtggctaaacaatttgatgaact 262  Q
    ||||| ||||||| | |||||||||||||||||||||| | | |||| |||| |||| ||||||||||||       |||||||||||||||||||| ||    
43268302 cttttgttgttggggactatgttccttggcttgattggttcagccatctttcaggatattatgcaagagcaaaaaaggtggctaaacaatttgatgatct 43268203  T
263 tttggaagatgtagttgaagatcatatcaatcgtcagaaaggagtcaatgaagaccatgatgactttgttgatgttttgctttggatccaaaagacagaa 362  Q
    |||||| | ||| |||||||||||||| |||  || ||||||||  | ||| || ||||||||||||||||| |||||||||||||||||||  ||||||    
43268202 tttggagggtgttgttgaagatcatatgaataatccgaaaggagatagtgacgagcatgatgactttgttgaagttttgctttggatccaaagaacagaa 43268103  T
363 tcacttggctttcctattgatagaacaattataaaagctctcctattggtaagtgtaaaattaaaatctct 433  Q
    |||||||||||||||||||| | |||  | ||||| ||||| ||| ||||| |||||||| ||||||||||    
43268102 tcacttggctttcctattgacaaaacggtcataaaggctctactactggtatgtgtaaaactaaaatctct 43268032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 24 - 306
Target Start/End: Complemental strand, 43311032 - 43310750
Alignment:
24 ttacctgtgaatataagtgaattagcctccaaaattactaatgatatagtttgtagggttgctttaggaagaaaatatgatggtgaaagtggaaagggat 123  Q
    ||||| |||||||||||||| |||  ||||| || ||  |||||||||||||||||||||||||| || ||||| |||  |||||||||||| |||||||    
43311032 ttacccgtgaatataagtgatttactctccacaactatcaatgatatagtttgtagggttgctttggggagaaagtatagtggtgaaagtgggaagggat 43310933  T
124 ttaagaagttgttgagggaatttaacgagtcacttagtgcttttattgttggagcctatgttccttggcttgattgggtgacccatgtttctggatttta 223  Q
    |||| ||||| ||   ||| ||||  |||| |||| || ||||| ||||||| | |||||||||||||||||||||| ||||| ||||||||||||||||    
43310932 ttaaaaagttattattggattttactgagttacttggtacttttgttgttggtgactatgttccttggcttgattggatgaccaatgtttctggatttta 43310833  T
224 tgcaagagcnnnnnnngtggctaaacaatttgatgaacttttggaagatgtagttgaagatcatatcaatcgtcagaaaggag 306  Q
    |||||||||       || |||||||| |||||||| |||||||| |||||||||||||||||||||||||||| ||||||||    
43310832 tgcaagagcaaaaaaagttgctaaacagtttgatgatcttttggaggatgtagttgaagatcatatcaatcgtcggaaaggag 43310750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 463 - 784
Target Start/End: Complemental strand, 43308224 - 43307903
Alignment:
463 tattgaccatgtatttgtttatatttaggacatgtttattggaggtacagacaccatatccagtttgctagagtgggaaatgactgaactcataaggcat 562  Q
    ||||||||||  |||||||||| || |||||||||||  || |||||| ||||| |||||||  ||||||||||||  |||||| |||||| |||| |||    
43308224 tattgaccatcaatttgtttatcttcaggacatgttttctgcaggtactgacactatatccaccttgctagagtggtcaatgacagaactcttaagacat 43308125  T
563 ccaaatatcatgaagaaattgcaagaagaagcaaggttggtggctaatggtagaaaacacataactgaagaagatttgagtcacatgaactacttaaggg 662  Q
    ||||||||||||||||||||||||||||||| ||||   || |||     ||||| ||||||||||||||| |||||| || ||||||| ||||||   |    
43308124 ccaaatatcatgaagaaattgcaagaagaagtaaggagtgtagctggcaatagaacacacataactgaagatgatttgggtaacatgaaatacttacaag 43308025  T
663 cagtggttaaagaaaccctacgtttacatcctccatttccattactagtcccaagagtaaacacacaagatatcaaattaaatggttaccacattaaagc 762  Q
    ||||||||||||||||  |||| |||||||||||| | ||  ||||||| ||||||| ||| | |||||||||||   |||| ||||||||||| |||||    
43308024 cagtggttaaagaaacattacggttacatcctccaatccccctactagttccaagagaaaatagacaagatatcaccgtaaagggttaccacatcaaagc 43307925  T
763 tggcacacatgttattatcaat 784  Q
    ||||||||  || |||||||||    
43307924 tggcacacgagtaattatcaat 43307903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 323 - 431
Target Start/End: Complemental strand, 43310706 - 43310598
Alignment:
323 tgactttgttgatgttttgctttggatccaaaagacagaatcacttggctttcctattgatagaacaattataaaagctctcctattggtaagtgtaaaa 422  Q
    |||||||||||||||||||||||||||||||| ||||||||| || || ||||||||||| | |||| | || || || ||  |||||||||||||||||    
43310706 tgactttgttgatgttttgctttggatccaaaggacagaatccctaggttttcctattgacaaaacagtcattaaggccctgttattggtaagtgtaaaa 43310607  T
423 ttaaaatct 431  Q
     ||||||||    
43310606 ctaaaatct 43310598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 78132 times since January 2019
Visitors: 2276