View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9310-LTR4-TNT-insertion-3 (Length: 251)

Name: F9310-LTR4-TNT-insertion-3
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9310-LTR4-TNT-insertion-3
[»] chr1 (4 HSPs)
chr1 (10-242)||(47018310-47018542)
chr1 (19-132)||(10719183-10719296)
chr1 (19-132)||(47047381-47047494)
chr1 (19-132)||(10714489-10714602)

Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 4)
Name: chr1

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 47018542 - 47018310
10 atccccgtgtgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgag 109  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47018542 atccccgtgtgattatggaaataaaagctcttttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgag 47018443  T
110 tatggtttggttataaatataatctagnnnnnnnactgttatgtttttccttgacgacaaaagaactacaccccttctagaaaaatttgccaaaatttta 209  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47018442 tatggtttggttataaatataatctagtttttttactgttatgtttttccttgacgacaaaagaactacaccccttctagaaaaatttgccaaaatttta 47018343  T
210 tgttatttacagtgggctaaagttcaacaattg 242  Q
47018342 tgttatttacagtgggctaaagttcaacaattg 47018310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 10719296 - 10719183
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| |||||||||||| ||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
10719296 tgatcatggaaataaaaactcttttgaagtgcagacagctcctataagtgatggtgttcttccagggataatacgtcaactagtgcttgagtatggtttg 10719197  T
119 gttataaatataat 132  Q
     |||||||| ||||    
10719196 tttataaatttaat 10719183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 47047494 - 47047381
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| |||||||||||| ||| |||||||||||||| |||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||    
47047494 tgatcatggaaataaaaactcttttgaagtgcagacagctcctatcaatgatggtgttcttccagggataatacgtcaactagtgcttgagtatggtttg 47047395  T
119 gttataaatataat 132  Q
     |||||||| ||||    
47047394 tttataaatctaat 47047381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 10714489 - 10714602
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| ||||||| |||| ||| ||| ||||||||||  ||||||  ||||||||||||||   ||| |||||||| ||||||||||||||||||| || |    
10714489 tgatcatggaaaaaaaaactcttttaaagtgcagacaactcctaatagtgatggtgttctattagggataatacgtcaactagtgcttgagtatgattcg 10714588  T
119 gttataaatataat 132  Q
     |||||||| ||||    
10714589 tttataaatctaat 10714602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84210 times since January 2019
Visitors: 2323