View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9310-LTR4-TNT-insertion-3 (Length: 251)

Name: F9310-LTR4-TNT-insertion-3
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9310-LTR4-TNT-insertion-3
F9310-LTR4-TNT-insertion-3
[»] chr1 (4 HSPs)
chr1 (10-242)||(47018310-47018542)
chr1 (19-132)||(10719183-10719296)
chr1 (19-132)||(47047381-47047494)
chr1 (19-132)||(10714489-10714602)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 47018542 - 47018310
Alignment:
10 atccccgtgtgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgag 109  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47018542 atccccgtgtgattatggaaataaaagctcttttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgag 47018443  T
110 tatggtttggttataaatataatctagnnnnnnnactgttatgtttttccttgacgacaaaagaactacaccccttctagaaaaatttgccaaaatttta 209  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47018442 tatggtttggttataaatataatctagtttttttactgttatgtttttccttgacgacaaaagaactacaccccttctagaaaaatttgccaaaatttta 47018343  T
210 tgttatttacagtgggctaaagttcaacaattg 242  Q
    |||||||||||||||||||||||||||||||||    
47018342 tgttatttacagtgggctaaagttcaacaattg 47018310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 10719296 - 10719183
Alignment:
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| |||||||||||| ||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
10719296 tgatcatggaaataaaaactcttttgaagtgcagacagctcctataagtgatggtgttcttccagggataatacgtcaactagtgcttgagtatggtttg 10719197  T
119 gttataaatataat 132  Q
     |||||||| ||||    
10719196 tttataaatttaat 10719183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 47047494 - 47047381
Alignment:
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| |||||||||||| ||| |||||||||||||| |||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||    
47047494 tgatcatggaaataaaaactcttttgaagtgcagacagctcctatcaatgatggtgttcttccagggataatacgtcaactagtgcttgagtatggtttg 47047395  T
119 gttataaatataat 132  Q
     |||||||| ||||    
47047394 tttataaatctaat 47047381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 10714489 - 10714602
Alignment:
19 tgattatggaaataaaagctcctttgaagtgcagacggctcctatcagtgatggtgttcttccaggaataatacgccaactagtgcttgagtatggtttg 118  Q
    |||| ||||||| |||| ||| ||| ||||||||||  ||||||  ||||||||||||||   ||| |||||||| ||||||||||||||||||| || |    
10714489 tgatcatggaaaaaaaaactcttttaaagtgcagacaactcctaatagtgatggtgttctattagggataatacgtcaactagtgcttgagtatgattcg 10714588  T
119 gttataaatataat 132  Q
     |||||||| ||||    
10714589 tttataaatctaat 10714602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC