View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9310-LTR4-TNT-insertion-7 (Length: 223)

Name: F9310-LTR4-TNT-insertion-7
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9310-LTR4-TNT-insertion-7
F9310-LTR4-TNT-insertion-7
[»] chr1 (3 HSPs)
chr1 (6-213)||(32164626-32164833)
chr1 (145-213)||(32167642-32167710)
chr1 (145-210)||(27359395-27359460)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 6 - 213
Target Start/End: Original strand, 32164626 - 32164833
Alignment:
6 cacaaattacacaaaacatagttgcagttttgcatttaagtagactttgttcgcagtctttctgctagttactaaatattgtgttaataaatatgaaagt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32164626 cacaaattacacaaaacatagttgcagttttgcatttaagtagactttgttcgcagtctttctgctagttactaaatattgtgttaataaatatgaaagt 32164725  T
106 tagaagactaaggaattacaagtaaatcttctcctgttttctttatatcaattatggaagcaccatttgttgcctcagaaatgagtgaagtatcatcaga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32164726 tagaagactaaggaattacaagtaaatcttctcctgttttctttatatcaattatggaagcaccatttgttgcctcagaaatgagtgaagtatcatcaga 32164825  T
206 attgaatt 213  Q
    ||||||||    
32164826 attgaatt 32164833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 213
Target Start/End: Original strand, 32167642 - 32167710
Alignment:
145 tctttatatcaattatggaagcaccatttgttgcctcagaaatgagtgaagtatcatcagaattgaatt 213  Q
    ||||||||||||| ||||||||||||||   |||  |||||||||||||||| |||| |||||||||||    
32167642 tctttatatcaataatggaagcaccattcaatgctccagaaatgagtgaagtgtcattagaattgaatt 32167710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 27359460 - 27359395
Alignment:
145 tctttatatcaattatggaagcaccatttgttgcctcagaaatgagtgaagtatcatcagaattga 210  Q
    |||||||||||||||| |||||||||     ||| |||||||||||||||||||||||| ||||||    
27359460 tctttatatcaattatagaagcaccacccaatgcttcagaaatgagtgaagtatcatcaaaattga 27359395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC