View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9310-LTR4-TNT-insertion-9 (Length: 207)

Name: F9310-LTR4-TNT-insertion-9
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9310-LTR4-TNT-insertion-9
F9310-LTR4-TNT-insertion-9
[»] chr8 (1 HSPs)
chr8 (8-199)||(14999726-14999918)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 199
Target Start/End: Original strand, 14999726 - 14999918
Alignment:
8 gctaacgaatactacctttcatattcgatatccttccttccttcctcccaaatccaaatggcttcaagggaagaagatcacaaggttagttatgattatt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14999726 gctaacgaatactacctttcatattcgatatccttccttccttcctcccaaatccaaatggcttcaagggaagaagatcacaaggttagttatgattatt 14999825  T
108 gtaagcaacaaatcctctcacttcccaaagagaaagggttatcaatccaagatttatattttttcc-aaagtttttggtgtccaccaatatta 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
14999826 gtaagcaacaaatcctctcacttcccaaagagaaagggttatcaatccaagatttatattttttccaaaagtttttggtgtccaccaatatta 14999918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84069 times since January 2019
Visitors: 2323