View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-10 (Length: 496)

Name: F9311-LTR4-TNT-insertion-10
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-10
F9311-LTR4-TNT-insertion-10
[»] chr8 (5 HSPs)
chr8 (7-486)||(37212728-37213207)
chr8 (7-211)||(37218077-37218281)
chr8 (309-366)||(37196070-37196127)
chr8 (306-361)||(37203774-37203829)
chr8 (170-216)||(37203611-37203657)
[»] chr2 (3 HSPs)
chr2 (12-90)||(7528493-7528571)
chr2 (208-299)||(7528662-7528755)
chr2 (263-299)||(413109-413145)


Alignment Details
Target: chr8 (Bit Score: 472; Significance: 0; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 472; E-Value: 0
Query Start/End: Original strand, 7 - 486
Target Start/End: Original strand, 37212728 - 37213207
Alignment:
7 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37212728 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 37212827  T
107 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37212828 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 37212927  T
207 ccacaaggcagcaagttgaagttagtgttaaatttaaaataacaagacagataatattttttagagaaaccgaggaaacatgtcattgtacattaagtcc 306  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37212928 ccacaaggcaacaagttgaagttagtgttaaatttaaaataacaagacagataatattttttagagaaaccgaggaaacatgtcattgtacattaagtcc 37213027  T
307 taagcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgttctattcaaggctaaactaaatattatagaaaatttcctttaacac 406  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37213028 taagcatatacattgatgaagaggttttccattgttataaacaaccaaaaatgttctattcaaggctaaactaaatattatagaaaatttcctttaacac 37213127  T
407 ttacttcctactgtgagtaaaaatgagaagatcacttttcatgtgtggtgaacaaaaagatgttacttttttagttatta 486  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37213128 ttacttcctactgtgagtaaaaatgagaagatcacttttcatgtgtggtgaacaaaaagatgttacttttttagttatta 37213207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 7 - 211
Target Start/End: Original strand, 37218077 - 37218281
Alignment:
7 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37218077 aatgtcttcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 37218176  T
107 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 206  Q
    |||||||||||||| |||||||||||||||||||||||| |    |||||||  | |||||| || |||| ||||||||||| ||||| |||||||||||    
37218177 agatctcaaagtgcgacggagatcagaaatcattgtggactttggatttaatttctttctaggagtgacacggcaatccctatactctaactgaacatat 37218276  T
207 ccaca 211  Q
     ||||    
37218277 acaca 37218281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 309 - 366
Target Start/End: Original strand, 37196070 - 37196127
Alignment:
309 agcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgttctatt 366  Q
    ||||||| |||||||||||||||||| | ||||||||||||||||||| |||| ||||    
37196070 agcatatgcattgatgaagaggttttgctttgctataaacaaccaaaagtgttttatt 37196127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 306 - 361
Target Start/End: Original strand, 37203774 - 37203829
Alignment:
306 ctaagcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgtt 361  Q
    |||||||||||||||||| |||||||||| | ||| ||||||||||||||| ||||    
37203774 ctaagcatatacattgataaagaggttttgctttgttataaacaaccaaaagtgtt 37203829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 37203611 - 37203657
Alignment:
170 agagacagggcaatccctagactctgactgaacatatccacaaggca 216  Q
    ||||||||||||||||| |||||| |||||||||||| |||||||||    
37203611 agagacagggcaatcccaagactcagactgaacatatacacaaggca 37203657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 7528493 - 7528571
Alignment:
12 cctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaag 90  Q
    |||||||||||||||||   |||||| ||  |||||||||||||||| |||| ||||||| ||||||| ||||||||||    
7528493 cctcttgatatatgaggctctgaacacctacacaaagatgttgttccagttttaacaggcgttttagacgatctcaaag 7528571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 208 - 299
Target Start/End: Original strand, 7528662 - 7528755
Alignment:
208 cacaaggcagcaagttgaagttagtgttaaatttaaaataacaa---gacagataatattttttagagaaaccgaggaaacatgtcattgtacat 299  Q
    ||||||||| ||||||||||||||  |||||| ||||| |||||   |||||| | | | ||||||||||||  |||||||||||||||||||||    
7528662 cacaaggcaacaagttgaagttaggattaaatctaaaacaacaacaagacaga-attttattttagagaaactcaggaaacatgtcattgtacat 7528755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 263 - 299
Target Start/End: Complemental strand, 413145 - 413109
Alignment:
263 ttttttagagaaaccgaggaaacatgtcattgtacat 299  Q
    ||||||||||||||| | |||||||||||||||||||    
413145 ttttttagagaaacctaagaaacatgtcattgtacat 413109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC