View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-10 (Length: 496)

Name: F9311-LTR4-TNT-insertion-10
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-10
[»] chr8 (5 HSPs)
chr8 (7-486)||(37212728-37213207)
chr8 (7-211)||(37218077-37218281)
chr8 (309-366)||(37196070-37196127)
chr8 (306-361)||(37203774-37203829)
chr8 (170-216)||(37203611-37203657)
[»] chr2 (3 HSPs)
chr2 (12-90)||(7528493-7528571)
chr2 (208-299)||(7528662-7528755)
chr2 (263-299)||(413109-413145)

Alignment Details
Target: chr8 (Bit Score: 472; Significance: 0; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 472; E-Value: 0
Query Start/End: Original strand, 7 - 486
Target Start/End: Original strand, 37212728 - 37213207
7 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 106  Q
37212728 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 37212827  T
107 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 206  Q
37212828 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 37212927  T
207 ccacaaggcagcaagttgaagttagtgttaaatttaaaataacaagacagataatattttttagagaaaccgaggaaacatgtcattgtacattaagtcc 306  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37212928 ccacaaggcaacaagttgaagttagtgttaaatttaaaataacaagacagataatattttttagagaaaccgaggaaacatgtcattgtacattaagtcc 37213027  T
307 taagcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgttctattcaaggctaaactaaatattatagaaaatttcctttaacac 406  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37213028 taagcatatacattgatgaagaggttttccattgttataaacaaccaaaaatgttctattcaaggctaaactaaatattatagaaaatttcctttaacac 37213127  T
407 ttacttcctactgtgagtaaaaatgagaagatcacttttcatgtgtggtgaacaaaaagatgttacttttttagttatta 486  Q
37213128 ttacttcctactgtgagtaaaaatgagaagatcacttttcatgtgtggtgaacaaaaagatgttacttttttagttatta 37213207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 7 - 211
Target Start/End: Original strand, 37218077 - 37218281
7 aatgtcctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37218077 aatgtcttcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaagagcatcggcgaccaga 37218176  T
107 agatctcaaagtgcaacggagatcagaaatcattgtggaatccaaatttaatcgccttctagtagagacagggcaatccctagactctgactgaacatat 206  Q
    |||||||||||||| |||||||||||||||||||||||| |    |||||||  | |||||| || |||| ||||||||||| ||||| |||||||||||    
37218177 agatctcaaagtgcgacggagatcagaaatcattgtggactttggatttaatttctttctaggagtgacacggcaatccctatactctaactgaacatat 37218276  T
207 ccaca 211  Q
37218277 acaca 37218281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 309 - 366
Target Start/End: Original strand, 37196070 - 37196127
309 agcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgttctatt 366  Q
    ||||||| |||||||||||||||||| | ||||||||||||||||||| |||| ||||    
37196070 agcatatgcattgatgaagaggttttgctttgctataaacaaccaaaagtgttttatt 37196127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 306 - 361
Target Start/End: Original strand, 37203774 - 37203829
306 ctaagcatatacattgatgaagaggttttccattgctataaacaaccaaaaatgtt 361  Q
    |||||||||||||||||| |||||||||| | ||| ||||||||||||||| ||||    
37203774 ctaagcatatacattgataaagaggttttgctttgttataaacaaccaaaagtgtt 37203829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 37203611 - 37203657
170 agagacagggcaatccctagactctgactgaacatatccacaaggca 216  Q
    ||||||||||||||||| |||||| |||||||||||| |||||||||    
37203611 agagacagggcaatcccaagactcagactgaacatatacacaaggca 37203657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 7528493 - 7528571
12 cctcttgatatatgagggcgtgaacatcttgacaaagatgttgttccggtttcaacaggcattttagaggatctcaaag 90  Q
    |||||||||||||||||   |||||| ||  |||||||||||||||| |||| ||||||| ||||||| ||||||||||    
7528493 cctcttgatatatgaggctctgaacacctacacaaagatgttgttccagttttaacaggcgttttagacgatctcaaag 7528571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 208 - 299
Target Start/End: Original strand, 7528662 - 7528755
208 cacaaggcagcaagttgaagttagtgttaaatttaaaataacaa---gacagataatattttttagagaaaccgaggaaacatgtcattgtacat 299  Q
    ||||||||| ||||||||||||||  |||||| ||||| |||||   |||||| | | | ||||||||||||  |||||||||||||||||||||    
7528662 cacaaggcaacaagttgaagttaggattaaatctaaaacaacaacaagacaga-attttattttagagaaactcaggaaacatgtcattgtacat 7528755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 263 - 299
Target Start/End: Complemental strand, 413145 - 413109
263 ttttttagagaaaccgaggaaacatgtcattgtacat 299  Q
    ||||||||||||||| | |||||||||||||||||||    
413145 ttttttagagaaacctaagaaacatgtcattgtacat 413109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94952 times since January 2019
Visitors: 2222