View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-13 (Length: 500)

Name: F9311-LTR4-TNT-insertion-13
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-13
F9311-LTR4-TNT-insertion-13
[»] chr7 (1 HSPs)
chr7 (7-491)||(11807442-11807926)
[»] chr8 (1 HSPs)
chr8 (8-491)||(44248525-44249008)
[»] chr3 (1 HSPs)
chr3 (8-487)||(51382750-51383223)
[»] chr5 (5 HSPs)
chr5 (240-491)||(15274357-15274608)
chr5 (7-191)||(15283852-15284036)
chr5 (8-410)||(15262144-15262543)
chr5 (222-382)||(15288097-15288257)
chr5 (32-102)||(15287898-15287968)


Alignment Details
Target: chr7 (Bit Score: 485; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 7 - 491
Target Start/End: Original strand, 11807442 - 11807926
Alignment:
7 aaaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttgg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11807442 aaaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttgg 11807541  T
107 cccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccacctcccaatagagcct 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11807542 cccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccacctcccaatagagcct 11807641  T
207 atatgattgatatatttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttca 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11807642 atatgattgatatatttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttca 11807741  T
307 tgttgctcatgagtttaagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttcc 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11807742 tgttgctcatgagtttaagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttcc 11807841  T
407 attgacaatgcaattctgattttccctgatctcattacatgttgtcccattatacaaagggcctctcttgtcatgaacccaattg 491  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11807842 attgacaatgcaattctgattttccctgatctcattacatgttgtcccattatacaaagggcctctcttgtcatgaacccaattg 11807926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 8 - 491
Target Start/End: Original strand, 44248525 - 44249008
Alignment:
8 aaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttggc 107  Q
    ||||||||||||||||||||||| |||| |||| ||||||||||||||| | |||||  ||| | |||| ||||| |||| |||||||||||| | |||     
44248525 aaaccaatgaccaaatgacaacacaatcgagtcaatttgatctatatccctagcccacatctgatttacttgatctaaatatattgtattatattgtgga 44248624  T
108 ccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccacctcccaatagagccta 207  Q
    || |||||| ||||||||||||||||||||||||| |||| |||||||| |||||||||||| |||||||||||||| |||||||| |||  ||||||||    
44248625 ccatcctttattctttgatcacccttcacaagaaaaggtgaccaataggctgtcaagtttgcgttgtaagaaggaaagtaccaccttccatcagagccta 44248724  T
208 tatgattgatatatttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttcat 307  Q
    |||| | || |  ||||||  |||| ||||||||||||||||||||||||||||||| ||||||  | | ||||||||||||||||||| ||||||||||    
44248725 tatggtggacacgtttagggcttgatacagtggataataagcaaataagggactctatttggttatttgctaaagagtctccaacaaaagctatgttcat 44248824  T
308 gttgctcatgagtttaagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttcca 407  Q
    |||  | ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||    
44248825 gtttttgatgagtttaagaaaagtgtttggttcaaaaattggaagatcacactcacttggtttccatctccaatataggtagcttgagtcaggtcttcca 44248924  T
408 ttgacaatgcaattctgattttccctgatctcattacatgttgtcccattatacaaagggcctctcttgtcatgaacccaattg 491  Q
    ||||| |||||||||||| ||| | | || ||| |||||||||| ||||||||||||||  |||||||||||||||||||||||    
44248925 ttgacgatgcaattctgacttttctttatatcactacatgttgttccattatacaaaggagctctcttgtcatgaacccaattg 44249008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 8 - 487
Target Start/End: Complemental strand, 51383223 - 51382750
Alignment:
8 aaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttggc 107  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||  | |||||  ||||| | |||||||||||||  |||||||||||| |||||    
51383223 aaaccaatgaccaaatgataacacaatcaagtccatttgatctatatctctagcccacctctcattgacatgatccaaatacattgtattataaattggc 51383124  T
108 ccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccacctcccaatagagccta 207  Q
    |||   ||| |||||||| ||||| |||||||||| || | ||||||  | | |||||||||||||| ||||||||| |||||| | |   |||||||||    
51383123 cctctgttttttctttgaacacccctcacaagaaaaggcgaccaataaaaagacaagtttgcattgtgagaaggaaagtaccactttc---tagagccta 51383027  T
208 tatgattgatatatttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttcat 307  Q
     |||   || |  ||||||||||||| |||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||| |||| | |||    
51383026 gatggcggacacgtttaggttttgaagcagtggataataagcatataagggactcaatttggttcctagataaagagtctccaacaaaagctatatgcat 51382927  T
308 gttgctcatgagtttaagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttcca 407  Q
    |||| | |||||||||||||| |||||||| |||||| ||| ||||| ||||||| ||||||||||||||||||  |||||| ||| ||| |||||||||    
51382926 gttgttgatgagtttaagaaatgtgtttggttcaaaatttgaaagatgacactcacttggtttccatctccaatgaaggtagtttgagtccggtcttcca 51382827  T
408 ttgacaatgcaattctgattttccctgatctcattacatgttgtcccattatacaaagggcctctcttgtcatgaaccca 487  Q
    || || |||||||| ||| ||| | |||||   ||||||||||| ||||||||||||||  |||| |||||| |||||||    
51382826 ttaacgatgcaattttgacttttcgtgatc---ttacatgttgttccattatacaaaggagctctattgtcacgaaccca 51382750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 168; Significance: 8e-90; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 240 - 491
Target Start/End: Complemental strand, 15274608 - 15274357
Alignment:
240 gataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttcatgttgctcatgagtttaagaaaagtgtttgggt 339  Q
    ||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||| | |||||| |||||||||||||||| |    
15274608 gataataagcaaacaagggactctatttggttcctagctaaagagtctccaacaaaagctatgttcatgttgttgatgagtgtaagaaaagtgtttggtt 15274509  T
340 caaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttccattgacaatgcaattctgattttccctgatctc 439  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||  || ||| | |||||||    
15274508 caaaaattggaagatcacactcctttggtttccatctccaatataggtagtttgagtcaggtcttccattgacgatgcaatttcgacttttcttgatctc 15274409  T
440 attacatgttgtcccattatacaaagggcctctcttgtcatgaacccaattg 491  Q
    | |||||||||| |||||||||||||||||||||||||||| || |||||||    
15274408 actacatgttgttccattatacaaagggcctctcttgtcattaatccaattg 15274357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 15284036 - 15283852
Alignment:
7 aaaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttgg 106  Q
    |||||||||||||||||||||| | |||||||||||||| ||| |||||| |||||||  | ||| ||||||||||||||| |||||||||||| | |||    
15284036 aaaaccaatgaccaaatgacaaaacaatcaagtccattttatccatatcccttgcccacatttcatttacatgatccaaatatattgtattatattgtgg 15283937  T
107 cccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccac 191  Q
    ||| || ||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||    
15283936 cccatcattttttctttgatcacccttcacaagaaatggtgaccaatagaatgtcaagtttgcattgtgagaaggaaaataccac 15283852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 8 - 410
Target Start/End: Complemental strand, 15262543 - 15262144
Alignment:
8 aaaccaatgaccaaatgacaacataatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataatttggc 107  Q
    ||||||||  |||||||| |||| ||||||||| |||  ||| |||||||| ||| | || ||  | ||| |||||| ||||||||||||| ||||||||    
15262543 aaaccaatttccaaatgataacacaatcaagtcgattccatccatatccttcgccaatttttcgttaacacgatccagatgtattgtattaaaatttggc 15262444  T
108 ccttcctttcttctttgatcacccttcacaagaaatggtgcccaataggatgtcaagtttgcattgtaagaaggaaaataccacctcccaata-gagcct 206  Q
    ||    |||  ||||| |||||| | |||||||||||| | ||||||    |  ||  ||||||||| ||||||||||| |||||    |||  || |||    
15262443 ccggattttgatctttcatcaccttgcacaagaaatggcgaccaatacacagataatgttgcattgtgagaaggaaaatgccacc----aatgtgaacct 15262348  T
207 atatgattgatatatttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttca 306  Q
     |||| | || |  |||||||||||||||||| ||||| | ||||| ||| ||||| | |||||| |||| |||||| ||||||||||||  |||||       
15262347 ttatggtggacaggtttaggttttgaaacagttgataacatgcaaagaagagactcaaattggtttctagctaaagaatctccaacaaaagatatgtgtc 15262248  T
307 tgttgctcatgagtttaagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaatataggtagcttgtgtcaggtcttcc 406  Q
    ||||  |  | ||||  |||||||||||||| |||||  ||||||| |  ||||||||||||||||||||  | || |||||| ||| ||||||||||||    
15262247 tgtttttgcttagttggagaaaagtgtttggttcaaaccttggaagtttgcactcatttggtttccatctatagtaaaggtagtttgagtcaggtcttcc 15262148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 222 - 382
Target Start/End: Original strand, 15288097 - 15288257
Alignment:
222 ttaggttttgaaacagtggataataagcaaataagggactctagttggttcctagataaagagtctccaacaaaaactatgttcatgttgctcatgagtt 321  Q
    |||||| |||||  ||| ||||| | ||||| ||| ||||||| |||||||||||  ||||| |||||||||||| |||| |   ||||  | ||||| |    
15288097 ttaggtgttgaagtagtcgataacatgcaaagaagtgactctaattggttcctagccaaagaatctccaacaaaagctatatgtttgttcttaatgagat 15288196  T
322 taagaaaagtgtttgggtcaaaaattggaagatcacactcatttggtttccatctccaata 382  Q
    | || ||||||||||| |||||  |||| |||| ||||||| |||| ||||||||||||||    
15288197 tgaggaaagtgtttggttcaaaccttggtagattacactcacttggcttccatctccaata 15288257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 32 - 102
Target Start/End: Original strand, 15287898 - 15287968
Alignment:
32 aatcaagtccatttgatctatatcctttgcccaattctcacttacatgatccaaatgtattgtattataat 102  Q
    ||||| |||||||||||| ||||||||||||||  ||||| | ||| ||||||||   |||||||||||||    
15287898 aatcatgtccatttgatcaatatcctttgcccacctctcattgacaagatccaaaaacattgtattataat 15287968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93765 times since January 2019
Visitors: 2365