View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-15 (Length: 705)

Name: F9311-LTR4-TNT-insertion-15
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9311-LTR4-TNT-insertion-15
F9311-LTR4-TNT-insertion-15
[»] chr2 (1 HSPs)
chr2 (8-695)||(13048370-13049057)


Alignment Details
Target: chr2 (Bit Score: 613; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 613; E-Value: 0
Query Start/End: Original strand, 8 - 695
Target Start/End: Complemental strand, 13049057 - 13048370
Alignment:
8 cttacctgttgatacatattatttcatatatagtggtaaaacgagggtttgtcttttggcaaactaatagtgacttctaactgttttgtatgattgaatt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13049057 cttacctgttgatacatattatttcatatatagtggtaaaacgagggtttgtcttttggcaaactaatagtgacttctaactgttttgtatgattgaatt 13048958  T
108 ctaaataaagctttcattttaggggtatctttcaattctcactttgttaccaggtgccacattataggggccctctttctgctaccatcaaatatagcta 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13048957 ctaaataaagctttcattttaggggtatctttcaattctcactttgttaccaggtgccacattataggggccctctttctgctaccatcaaatatagcta 13048858  T
208 gattcccatgcacctggaataactatgtatacatgcattcacacaatctcatccgttcaatctcaattctatacaacnnnnnnngtgatatagtggctga 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
13048857 gattcccatgcacctggaataactatgtatacatgcattcacacaatctcatccgttcaatctcaattctatacaacaaaaaaagtgatatagtggctga 13048758  T
308 tttagcgaccaacttaaagaccaaaaatgtcaannnnnnngctaatattagtagtagtgttttggcgatatttttcacactggtctctaaatcgaccaca 407  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13048757 tttagcgaccaacttaaagaccaaaaatgtcaatttttttgctaatattagtagtagtgttttggcgatatttttcacactggtctctaaatcgaccaca 13048658  T
408 aactcatttaactatcgatttagaaactagtttagcgattgatttggattcaatcgctaaatcggttgttagagacactaaaaaattttggttactaaga 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13048657 aactcatttaactatcgatttagaaactagtttagcgattgatttggattcaatcgctaaatcggttgttagagacactaaaaaattttggttactaaga 13048558  T
508 ttgttgctaaatagcaaatttttagttttgattagacaattcattcttattctaatatcacaaaacaagtctaaaatacaaagttaaaacatcgacggtt 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13048557 ttgttgctaaatagcaaatttttagttttgattagacaattcattcttattctaatatcacaaaacaagtctaaaatacaaagttaaaacatcgacggtt 13048458  T
608 taatcaagatcaaatgatttccttaattaaatatggttcaaatccccttttgagnnnnnnnnnnnggttttgaaacagcaatatatta 695  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||    
13048457 taatcaagatcaaatgatttccttaattaaatatggttcaaatccccttttgagtttttttttttggttttgaaacagcaatatatta 13048370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98119 times since January 2019
Visitors: 2269