View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9311-LTR4-TNT-insertion-15 (Length: 705)

Name: F9311-LTR4-TNT-insertion-15
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9311-LTR4-TNT-insertion-15
[»] chr2 (1 HSPs)
chr2 (8-695)||(13048370-13049057)

Alignment Details
Target: chr2 (Bit Score: 613; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 613; E-Value: 0
Query Start/End: Original strand, 8 - 695
Target Start/End: Complemental strand, 13049057 - 13048370
8 cttacctgttgatacatattatttcatatatagtggtaaaacgagggtttgtcttttggcaaactaatagtgacttctaactgttttgtatgattgaatt 107  Q
13049057 cttacctgttgatacatattatttcatatatagtggtaaaacgagggtttgtcttttggcaaactaatagtgacttctaactgttttgtatgattgaatt 13048958  T
108 ctaaataaagctttcattttaggggtatctttcaattctcactttgttaccaggtgccacattataggggccctctttctgctaccatcaaatatagcta 207  Q
13048957 ctaaataaagctttcattttaggggtatctttcaattctcactttgttaccaggtgccacattataggggccctctttctgctaccatcaaatatagcta 13048858  T
208 gattcccatgcacctggaataactatgtatacatgcattcacacaatctcatccgttcaatctcaattctatacaacnnnnnnngtgatatagtggctga 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
13048857 gattcccatgcacctggaataactatgtatacatgcattcacacaatctcatccgttcaatctcaattctatacaacaaaaaaagtgatatagtggctga 13048758  T
308 tttagcgaccaacttaaagaccaaaaatgtcaannnnnnngctaatattagtagtagtgttttggcgatatttttcacactggtctctaaatcgaccaca 407  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13048757 tttagcgaccaacttaaagaccaaaaatgtcaatttttttgctaatattagtagtagtgttttggcgatatttttcacactggtctctaaatcgaccaca 13048658  T
408 aactcatttaactatcgatttagaaactagtttagcgattgatttggattcaatcgctaaatcggttgttagagacactaaaaaattttggttactaaga 507  Q
13048657 aactcatttaactatcgatttagaaactagtttagcgattgatttggattcaatcgctaaatcggttgttagagacactaaaaaattttggttactaaga 13048558  T
508 ttgttgctaaatagcaaatttttagttttgattagacaattcattcttattctaatatcacaaaacaagtctaaaatacaaagttaaaacatcgacggtt 607  Q
13048557 ttgttgctaaatagcaaatttttagttttgattagacaattcattcttattctaatatcacaaaacaagtctaaaatacaaagttaaaacatcgacggtt 13048458  T
608 taatcaagatcaaatgatttccttaattaaatatggttcaaatccccttttgagnnnnnnnnnnnggttttgaaacagcaatatatta 695  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||    
13048457 taatcaagatcaaatgatttccttaattaaatatggttcaaatccccttttgagtttttttttttggttttgaaacagcaatatatta 13048370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC